VDAC3 antibody
70R-21249 50 ul
EUR 435
Description: Rabbit polyclonal VDAC3 antibody
VDAC3 Antibody
42830-100ul 100ul
EUR 252
VDAC3 Antibody
DF12499 200ul
EUR 304
Description: VDAC3 antibody detects endogenous levels of VDAC3.
VDAC3 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
VDAC3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
VDAC3 antibody
70R-5050 50 ug
EUR 467
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3
VDAC3 antibody
70R-5051 50 ug
EUR 467
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VDAC3 Rabbit pAb
A10544-100ul 100 ul
EUR 308
VDAC3 Rabbit pAb
A10544-200ul 200 ul
EUR 459
VDAC3 Rabbit pAb
A10544-20ul 20 ul
EUR 183
VDAC3 Rabbit pAb
A10544-50ul 50 ul
EUR 223
VDAC3 Blocking Peptide
33R-4733 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5051
VDAC3 Blocking Peptide
33R-8339 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5050
VDAC3 cloning plasmid
CSB-CL896484HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 852
  • Sequence: atgtgtaacacaccaacgtactgtgacctaggaaaggctgctaaggatgtcttcaacaaaggatatggctttggcatggtcaagatagacctgaaaaccaagtcttgtagtggagtggaattttctacttctggtcatgcttacactgatacagggaaagcatcaggcaacctaga
  • Show more
Description: A cloning plasmid for the VDAC3 gene.
VDAC3 Blocking Peptide
DF12499-BP 1mg
EUR 195
VDAC3 Conjugated Antibody
C42830 100ul
EUR 397
VDAC3 Rabbit pAb
A4183-100ul 100 ul
EUR 308
VDAC3 Rabbit pAb
A4183-200ul 200 ul
EUR 459
VDAC3 Rabbit pAb
A4183-20ul 20 ul Ask for price
VDAC3 Rabbit pAb
A4183-50ul 50 ul Ask for price
VDAC3 Polyclonal Antibody
ABP60884-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VDAC3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VDAC3 from Human, Mouse, Rat. This VDAC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VDAC3 protein
VDAC3 Polyclonal Antibody
ABP60884-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VDAC3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VDAC3 from Human, Mouse, Rat. This VDAC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VDAC3 protein
VDAC3 Polyclonal Antibody
ABP60884-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VDAC3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VDAC3 from Human, Mouse, Rat. This VDAC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VDAC3 protein
anti- VDAC3 antibody
FNab09388 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: voltage-dependent anion channel 3
  • Uniprot ID: Q9Y277
  • Gene ID: 7419
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC3
anti- VDAC3 antibody
FNab09389 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: voltage-dependent anion channel 3
  • Uniprot ID: Q9Y277
  • Gene ID: 7419
  • Research Area: Signal Transduction, Cancer, Metabolism
Description: Antibody raised against VDAC3
VDAC3 Polyclonal Antibody
ES10469-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
VDAC3 Polyclonal Antibody
ES10469-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-VDAC3 antibody
PAab09389 100 ug
EUR 386
Anti-VDAC3 (1C6)
YF-MA16053 100 ug
EUR 363
Description: Mouse monoclonal to VDAC3
Anti-VDAC3 antibody
STJ26082 100 µl
EUR 277
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene.
Anti-VDAC3 antibody
STJ112562 100 µl
EUR 277
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene.
Anti-VDAC3 antibody
STJ191627 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VDAC3
Polyclonal VDAC3 Antibody (Center)
APR10708G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VDAC3 (Center). This antibody is tested and proven to work in the following applications:
EF004187 96 Tests
EUR 689
Mouse Vdac3 ELISA KIT
ELI-51389m 96 Tests
EUR 865
ELI-44522b 96 Tests
EUR 928
Mouse VDAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat VDAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human VDAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-35275h 96 Tests
EUR 824
VDAC3 Recombinant Protein (Rat)
RP236342 100 ug Ask for price
VDAC3 Recombinant Protein (Human)
RP034300 100 ug Ask for price
VDAC3 Recombinant Protein (Mouse)
RP183728 100 ug Ask for price
VDAC3 Recombinant Protein (Mouse)
RP183731 100 ug Ask for price
Vdac3 ORF Vector (Mouse) (pORF)
ORF061244 1.0 ug DNA
EUR 506
Vdac3 ORF Vector (Mouse) (pORF)
ORF061245 1.0 ug DNA
EUR 506
Vdac3 ORF Vector (Rat) (pORF)
ORF078782 1.0 ug DNA
EUR 506
VDAC3 ORF Vector (Human) (pORF)
ORF011434 1.0 ug DNA
EUR 95
Vdac3 sgRNA CRISPR Lentivector set (Mouse)
K5012201 3 x 1.0 ug
EUR 339
Vdac3 sgRNA CRISPR Lentivector set (Rat)
K7022001 3 x 1.0 ug
EUR 339
VDAC3 sgRNA CRISPR Lentivector set (Human)
K2608701 3 x 1.0 ug
EUR 339
Voltage-Dependent Anion Channel 3 (VDAC3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5012202 1.0 ug DNA
EUR 154
Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5012203 1.0 ug DNA
EUR 154
Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5012204 1.0 ug DNA
EUR 154
Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7022002 1.0 ug DNA
EUR 154
Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7022003 1.0 ug DNA
EUR 154
Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7022004 1.0 ug DNA
EUR 154
VDAC3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2608702 1.0 ug DNA
EUR 154
VDAC3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2608703 1.0 ug DNA
EUR 154
VDAC3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2608704 1.0 ug DNA
EUR 154
Vdac3 3'UTR Luciferase Stable Cell Line
TU121749 1.0 ml Ask for price
VDAC3 3'UTR GFP Stable Cell Line
TU078093 1.0 ml
EUR 1394
Vdac3 3'UTR GFP Stable Cell Line
TU171749 1.0 ml Ask for price
Vdac3 3'UTR Luciferase Stable Cell Line
TU223023 1.0 ml Ask for price
VDAC3 3'UTR Luciferase Stable Cell Line
TU028093 1.0 ml
EUR 1394
Vdac3 3'UTR GFP Stable Cell Line
TU273023 1.0 ml Ask for price
VDAC3 Protein Vector (Mouse) (pPB-C-His)
PV244974 500 ng
EUR 603
VDAC3 Protein Vector (Mouse) (pPB-N-His)
PV244975 500 ng
EUR 603
VDAC3 Protein Vector (Mouse) (pPM-C-HA)
PV244976 500 ng
EUR 603
VDAC3 Protein Vector (Mouse) (pPM-C-His)
PV244977 500 ng
EUR 603
VDAC3 Protein Vector (Mouse) (pPB-C-His)
PV244978 500 ng
EUR 603