Are CSF CXCL13 concentrations solely dependent on intrathecal production? A commentary on "Chemokine CXCL13 in serum, CSF, and blood-CSF barrier function"

Are CSF CXCL13 concentrations solely dependent on intrathecal production? A commentary on “Chemokine CXCL13 in serum, CSF, and blood-CSF barrier function”

Pilz et al. (Fluids Barriers CNS 17:7; 2020) investigated how CSF CXCL13 concentrations are influenced by CXCL13 serum concentrations and blood-CSF barrier (BCSFB) perform, evaluating the affect of serum CXCL13 ranges and Qalbumin (CSF albumin/serum albumin) on CSF CXCL13 amongst sufferers with CNS irritation categorized as CXCL13 unfavourable, low, medium, or excessive.
Among all CXCL13 teams, their outcomes confirmed no correlation between CSF CXCL13 concentrations and serum CXCL13 or Qalbumin. The authors argue that, in distinction to different proteins, CXCL13 passage throughout the BCSFB doesn’t happen, no matter BCSFB perform, and is as an alternative solely influenced by intrathecal manufacturing.
In distinction to the authors’ findings, in our research together with each non-inflammatory neurological issues (NIND; n = 62) and a number of sclerosis (MS) sufferers we noticed a big correlation between serum CXCL13 concentrations and CSF CXCL13 concentrations.
We evaluation a number of observations which can underlie these contrasting outcomes, together with (1) the affect of serum CXCL13 concentrations on CSF CXCL13 in sufferers with decrease intrathecal CXCL13 manufacturing and thus decrease CXCL13 concentrations (i.e. NIND and MS), (2) the proposed diffusion dynamics of the small molecule CXCL13 throughout the BCSFB, and (3) differing definitions of unfavourable versus elevated CSF CXCL13 concentrations decided by an assay’s relative sensitivity. In conclusion, we argue that for sufferers with reasonably elevated CSF CXCL13 concentrations, serum CXCL13 concentrations affect CSF CXCL13 ranges, and thus the suitable corrections together with incorporation of CSF/serum ratios and Qalbumin values must be utilized.

The Specific Judo Training Program Combined With the Whole Body Cryostimulation Induced an Increase of Serum Concentrations of Growth Factors and Changes in Amino Acid Profile in Professional Judokas

This research aimed to guage the impact of a selected coaching program, supported by 10 classes of complete physique cryostimulation, on progress elements concentrations, amino acids profile and motor skills in skilled judokas. Ultimately, twelve athletes took half in the research. They had been randomly assigned to the cryostimulation group (CRY, n = 6) or the management group (CON, n = 6). During 2 weeks of the judo coaching program, the CRY group carried out 10 cryo-sessions (3-min, at a temperature of -110°C) and the CON group rested passively.
Anthropometric measurements, a energy take a look at, the Special Judo Efficiency Test (SJET) had been assessed 2 days earlier than and after the judo coaching program. Blood samples had been collected at relaxation, 1 h after the primary and the second SJET and 1 h after the primary and the final cryo-session to ascertain progress elements and amino acid concentrations.
Lactate degree was measured earlier than, instantly after and 1 h after the primary and the second SJET. The utilized intervention resulted in a big improve of resting concentrations of brain-derived neurotrophic issue (from 10.23 ± 1.61 to 15.13 ± 2.93 ng⋅ml-1p = 0.01) and insulin-like progress issue 1 (IGF-1; from 174.29 ± 49.34 to 300.50 ± 43.80 pg⋅ml-1p = 0.00) in the CRY group.
Are CSF CXCL13 concentrations solely dependent on intrathecal production? A commentary on "Chemokine CXCL13 in serum, CSF, and blood-CSF barrier function"
A totally different response was registered 1 h immediately put up SJET in the CRY group (a big improve of IGF-1, interleukin 15 and irisin: p = 0.01; p = 0.00; p = 0.03). Additionally, the numerous drop of proline and leucine concentrations in the CRY group was obtained. Athletes’ efficiency remained unchanged in each teams. However, topics perceived constructive adjustments induced by the intervention – in a roundabout way after cryostimulation however in response to the particular coaching workload. The improve of progress elements concentrations and the advance of amino acid profile (proline and leucine) contributed to sustaining a excessive degree of muscle perform.

Multivariate Investigation of Toxic and Essential Metals in the Serum from Various Types and Stages of Colorectal Cancer Patients

Colorectal most cancers (CRC) is at the moment one of the crucial frequent malignant neoplasms, rating third in incidence and 2nd in mortality each in the USA and internationally. The pathogenesis of CRC is a posh interplay between genetic susceptibility and environmental elements resembling publicity to metals. Therefore, the current research was meant to evaluate the imbalances in the concentrations of chosen important/poisonous parts (Pb, Cr, Fe, Zn, As, Cd, Cu, Se, Ni, and Hg) in the serum of newly identified colorectal carcinoma sufferers (n = 165) in comparability with counterpart controls (n = 151) by atomic absorption spectrometry after wet-acid digestion technique.
Serum carcinoembryonic antigen (CEA) of the CRC sufferers was decided utilizing immunoradiometric technique. Body mass index (BMI) which is a longtime threat issue for CRC was additionally calculated for sufferers and wholesome controls. Conversely, common Ni (2.721 μg/g), Cd (0.563 μg/g), As (0.539 μg/g), and Pb (1.273 μg/g) ranges had been considerably elevated in the serum of CRC sufferers in comparison with the wholesome donors, whereas the typical Se (7.052 μg/g), Fe (15.67 μg/g), Cu (2.033 μg/g), and Zn (8.059 μg/g) concentrations had been elevated in controls.
The correlation coefficients between the weather in the cancerous sufferers demonstrated considerably dissimilar communal relationships in contrast with the wholesome topics. Significant variations in the basic ranges had been additionally confirmed for CRC varieties (major colorectal lymphoma, gastrointestinal stromal tumor, and adenocarcinoma) and CRC levels (stage-I, stage-II, stage-III, and stage-IV) among the many sufferers. Majority of the weather demonstrated perceptible disparities in their ranges based mostly on dietary, habitat, gender, and smoking habits of the malignant sufferers and wholesome topics.

SAA4 antibody

70R-5924 50 ug
EUR 467
Description: Rabbit polyclonal SAA4 antibody raised against the middle region of SAA4

SAA4 Antibody

ABD7899 100 ug
EUR 438

SAA4 Antibody

ABD8088 100 ug
EUR 438

SAA4

E541-021 100ug
EUR 343

SAA4 Conjugated Antibody

C43534 100ul
EUR 397

SAA4 Polyclonal Antibody

ABP56119-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130

SAA4 Polyclonal Antibody

ABP56119-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130

SAA4 Polyclonal Antibody

ABP56119-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130

anti- SAA4 antibody

FNab07574 100µg
EUR 585
  • Immunogen: serum amyloid A4, constitutive
  • Uniprot ID: P35542
  • Gene ID: 6291
  • Research Area: Cardiovascular
Description: Antibody raised against SAA4

SAA4 Polyclonal Antibody

ES7118-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SAA4 from Human. This antibody is tested and validated for IHC, WB, ELISA

SAA4 Polyclonal Antibody

ES7118-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SAA4 from Human. This antibody is tested and validated for IHC, WB, ELISA

Anti-SAA4 antibody

PAab07574 100 ug
EUR 412

Anti-SAA4 antibody

STJ118868 100 µl
EUR 277

Anti-SAA4 antibody

STJ95571 200 µl
EUR 197
Description: Rabbit polyclonal to SAA4.

SAA4 siRNA

20-abx932387
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SAA4 siRNA

20-abx932388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SAA4

YF-PA14502 50 ug
EUR 363
Description: Mouse polyclonal to SAA4

anti-SAA4

YF-PA14503 100 ul
EUR 403
Description: Rabbit polyclonal to SAA4

anti-SAA4

YF-PA14504 100 ug
EUR 403
Description: Rabbit polyclonal to SAA4

anti-SAA4

YF-PA24657 50 ul
EUR 334
Description: Mouse polyclonal to SAA4

SAA4 Blocking Peptide

33R-1030 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF20L1 antibody, catalog no. 70R-8973

SAA4 Blocking Peptide

33R-8261 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SAA4 antibody, catalog no. 70R-5922

SAA4 Blocking Peptide

DF7899-BP 1mg
EUR 195

Human SAA4 Protein

abx060004-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

SAA4 cloning plasmid

CSB-CL020659HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 393
  • Sequence: atgaggcttttcacaggcattgttttctgctccttggtcatgggagtcaccagtgaaagctggcgttcgtttttcaaggaggctctccaaggggttggggacatgggcagagcctattgggacataatgatatccaatcaccaaaattcaaacagatatctctatgctcggggaaa
  • Show more
Description: A cloning plasmid for the SAA4 gene.

SAA4 Rabbit pAb

A16428-100ul 100 ul
EUR 308

SAA4 Rabbit pAb

A16428-200ul 200 ul
EUR 459

SAA4 Rabbit pAb

A16428-20ul 20 ul
EUR 183

SAA4 Rabbit pAb

A16428-50ul 50 ul
EUR 223

Anti-SAA4 (3C11)

YF-MA15335 100 ug
EUR 363
Description: Mouse monoclonal to SAA4

Monoclonal SAA4 Antibody, Clone: EPR2926

AMR09806G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SAA4. The antibodies are raised in Rabbit and are from clone EPR2926. This antibody is applicable in WB and IHC

Polyclonal SAA4 Antibody (C-term)

AMR09807G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAA4 (C-term). This antibody is tested and proven to work in the following applications:

Anti-SAA4/Serum Amyloid A4 Antibody

A07115 100ul
EUR 397
Description: Rabbit Polyclonal SAA4/Serum Amyloid A4 Antibody. Validated in IHC and tested in Human.

Serum Amyloid A4, Constitutive (SAA4) Antibody

20-abx128626
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serum Amyloid A4, Constitutive (SAA4) Antibody

20-abx174526
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Serum Amyloid A4, Constitutive (SAA4) Antibody

20-abx323184
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

SAA4 protein (His tag)

80R-1554 50 ug
EUR 397
Description: Purified recombinant Human SAA4 protein

Human SAA4 ELISA Kit

ELA-E10316h 96 Tests
EUR 824

SAA4 ELISA KIT|Human

EF002194 96 Tests
EUR 689

Mouse SAA4 shRNA Plasmid

20-abx972561
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SAA4 shRNA Plasmid

20-abx954237
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SAA4 Recombinant Protein (Human)

RP027541 100 ug Ask for price

SAA4 Recombinant Protein (Rat)

RP227402 100 ug Ask for price

SAA4 Recombinant Protein (Mouse)

RP169868 100 ug Ask for price

Human Serum Amyloid A-4 (SAA4) Antibody

13031-05011 150 ug
EUR 217

Serum Amyloid A-4 Protein (SAA4) Antibody

abx029249-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum Amyloid A-4 Protein (SAA4) Antibody

abx029249-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum Amyloid A-4 Protein (SAA4) Antibody

abx237574-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Serum amyloid A /SAA4/CSAA

E21-F15 10ug
EUR 343

Saa4 ORF Vector (Rat) (pORF)

ORF075802 1.0 ug DNA
EUR 506

SAA4 ORF Vector (Human) (pORF)

ORF009181 1.0 ug DNA
EUR 95

Saa4 ORF Vector (Mouse) (pORF)

ORF056624 1.0 ug DNA
EUR 506

SAA2-SAA4 Recombinant Protein (Human)

RP095754 100 ug Ask for price

SAA4 ELISA Kit (Human) (OKCD08499)

OKCD08499 96 Wells
EUR 975
Description: Description of target: SAA4 is a major acute phase reactant. It is an Apolipoprotein of the HDL complex.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

SAA4 ELISA Kit (Mouse) (OKEH05734)

OKEH05734 96 Wells
EUR 779
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

SAA4 ELISA Kit (Bovine) (OKEH07586)

OKEH07586 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

SAA4 ELISA Kit (Human) (OKEH02075)

OKEH02075 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Saa4 sgRNA CRISPR Lentivector set (Rat)

K7166301 3 x 1.0 ug
EUR 339

Saa4 sgRNA CRISPR Lentivector set (Mouse)

K3373601 3 x 1.0 ug
EUR 339

SAA4 sgRNA CRISPR Lentivector set (Human)

K2084901 3 x 1.0 ug
EUR 339

SAA2-SAA4 ORF Vector (Human) (pORF)

ORF031919 1.0 ug DNA Ask for price

Recombinant Serum Amyloid A4, Constitutive (SAA4)

4-RPD529Hu01
  • EUR 496.03
  • EUR 236.00
  • EUR 1585.12
  • EUR 595.04
  • EUR 1090.08
  • EUR 395.00
  • EUR 3812.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35542
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.2kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Serum Amyloid A4, Constitutive expressed in: E.coli

Human Serum Amyloid A-4 (SAA4) Antibody (Biotin Conjugate)

13031-05021 150 ug
EUR 276

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse)

4-PAD529Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4)

Human Serum Amyloid A4, Constitutive (SAA4) Protein

20-abx167047
  • EUR 690.00
  • EUR 286.00
  • EUR 2138.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Saa4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7166302 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7166303 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7166304 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3373602 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3373603 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3373604 1.0 ug DNA
EUR 154

SAA2-SAA4 sgRNA CRISPR Lentivector set (Human)

K2800601 3 x 1.0 ug
EUR 339

SAA4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2084902 1.0 ug DNA
EUR 154

SAA4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2084903 1.0 ug DNA
EUR 154

SAA4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2084904 1.0 ug DNA
EUR 154

SAA4 Serum Amyloid A4 Human Recombinant Protein

PROTP35542 Regular: 10ug
EUR 317
Description: SAA4 Human Recombinant fused with a 21 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 131 amino acids (21-130 a.a.) and having a molecular mass of 14.9kDa. The SAA4 is purified by proprietary chromatographic techniques.

SAA4 Protein Vector (Rat) (pPB-C-His)

PV303206 500 ng
EUR 603

SAA4 Protein Vector (Rat) (pPB-N-His)

PV303207 500 ng
EUR 603

SAA4 Protein Vector (Rat) (pPM-C-HA)

PV303208 500 ng
EUR 603

SAA4 Protein Vector (Rat) (pPM-C-His)

PV303209 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPB-C-His)

PV226494 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPB-N-His)

PV226495 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPM-C-HA)

PV226496 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPM-C-His)

PV226497 500 ng
EUR 603

SAA4 Protein Vector (Human) (pPB-C-His)

PV036721 500 ng
EUR 329

SAA4 Protein Vector (Human) (pPB-N-His)

PV036722 500 ng
EUR 329

SAA4 Protein Vector (Human) (pPM-C-HA)

PV036723 500 ng
EUR 329

SAA4 Protein Vector (Human) (pPM-C-His)

PV036724 500 ng
EUR 329

Recombinant Human SAA4 Protein, His, E.coli-10ug

QP13410-10ug 10ug
EUR 201

Recombinant Human SAA4 Protein, His, E.coli-1mg

QP13410-1mg 1mg
EUR 5251

Recombinant Human SAA4 Protein, His, E.coli-2ug

QP13410-2ug 2ug
EUR 155

Saa4 3'UTR Luciferase Stable Cell Line

TU118311 1.0 ml Ask for price

Saa4 3'UTR GFP Stable Cell Line

TU168311 1.0 ml Ask for price

Saa4 3'UTR Luciferase Stable Cell Line

TU219889 1.0 ml Ask for price

Saa4 3'UTR GFP Stable Cell Line

TU269889 1.0 ml Ask for price

SAA4 3'UTR GFP Stable Cell Line

TU072548 1.0 ml
EUR 1394

SAA4 3'UTR Luciferase Stable Cell Line

TU022548 1.0 ml
EUR 1394

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (FITC Conjugate)

13031-05041 150 ug
EUR 428

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (RPE Conjugate)

13031-05051 150 ug
EUR 428

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (APC Conjugate)

13031-05061 150 ug
EUR 428

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (PerCP Conjugate)

13031-05071 150 ug
EUR 471

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), APC

4-PAD529Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with APC.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAD529Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with Biotin.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), Cy3

4-PAD529Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with Cy3.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), FITC

4-PAD529Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with FITC.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), HRP

4-PAD529Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with HRP.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), PE

4-PAD529Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with PE.

ELISA kit for Human SAA4 (Serum Amyloid A4)

E-EL-H5638 1 plate of 96 wells
EUR 534
  • Gentaur's SAA4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SAA4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SAA4 (Serum Amyloid A4) in samples from Serum, Plasma, Cell supernatant

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

20-abx153011
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Human Serum Amyloid A4, Constitutive (SAA4) CLIA Kit

20-abx494308
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Serum Amyloid A-4 Protein (SAA4) Protein

20-abx262355
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV648229 1.0 ug DNA
EUR 514

SAA4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV648233 1.0 ug DNA
EUR 514

SAA4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV648234 1.0 ug DNA
EUR 514

SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2800602 1.0 ug DNA
EUR 154

SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2800603 1.0 ug DNA
EUR 154

SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2800604 1.0 ug DNA
EUR 154

SAA2-SAA4 Protein Vector (Human) (pPB-C-His)

PV127674 500 ng Ask for price

SAA2-SAA4 Protein Vector (Human) (pPB-N-His)

PV127675 500 ng Ask for price

SAA2-SAA4 Protein Vector (Human) (pPM-C-HA)

PV127676 500 ng Ask for price

SAA2-SAA4 Protein Vector (Human) (pPM-C-His)

PV127677 500 ng Ask for price

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

4-SED529Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Serum Amyloid A4, Constitutive elisa. Alternative names of the recognized antigen: C-SAA
  • CSAA
  • SA-A4
  • Constitutively expressed serum amyloid A protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Serum Amyloid A4, Constitutive (SAA4) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAD529Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with APC-Cy7.

Human Serum amyloid A-4 protein(SAA4) ELISA kit

CSB-EL020659HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serum amyloid A-4 protein (SAA4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Serum amyloid A-4 protein(SAA4) ELISA kit

1-CSB-EL020659HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serum amyloid A-4 protein(SAA4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Serum amyloid A-4 protein (SAA4) ELISA Kit

abx250406-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Saa4/ Serum amyloid A-4 protein ELISA Kit

E1304Mo 1 Kit
EUR 632

Human SAA4/ Serum amyloid A-4 protein ELISA Kit

E2208Hu 1 Kit
EUR 605

Human SAA4(Serum amyloid A-4 protein) ELISA Kit

EH1155 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P35542
  • Alias: SAA4(Serum amyloid A-4 protein)/CSAA/C-SAA/Constitutively expressed serum amyloid A protein/SAA5/serum amyloid A4, constitutive
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Bovine Serum amyloid A- 4 protein, SAA4 ELISA KIT

ELI-20131b 96 Tests
EUR 928

Human Serum amyloid A- 4 protein, SAA4 ELISA KIT

ELI-21759h 96 Tests
EUR 824

ELISA kit for Human SAA4 (Serum Amyloid A4, Constitutive)

ELK4953 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serum Amyloid A4, Constitutive (SAA4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Serum Amyloid A4, Constitutive from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cow Serum amyloid A-4 protein (SAA4) ELISA Kit

abx514753-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Serum amyloid A-4 protein (SAA4) ELISA Kit

abx514754-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Serum amyloid A-4 protein (SAA4) ELISA Kit

abx514755-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Serum amyloid A- 4 protein, Saa4 ELISA KIT

ELI-40813m 96 Tests
EUR 865

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV785495 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV785499 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV785500 1.0 ug DNA Ask for price

ELISA kit for Human Serum amyloid A-4 protein (SAA4)

KTE60753-48T 48T
EUR 332
  • Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serum amyloid A-4 protein (SAA4)

KTE60753-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serum amyloid A-4 protein (SAA4)

KTE60753-96T 96T
EUR 539
  • Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7166305 3 x 1.0 ug
EUR 376

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3373605 3 x 1.0 ug
EUR 376

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2084905 3 x 1.0 ug
EUR 376

Saa4 ELISA Kit| Mouse Serum amyloid A-4 protein ELISA Kit

EF016185 96 Tests
EUR 689

SAA4 ELISA Kit| Bovine Serum amyloid A-4 protein ELISA Kit

EF011896 96 Tests
EUR 689

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV648230 1.0 ug DNA
EUR 514

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV648231 1.0 ug DNA
EUR 572

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV648232 1.0 ug DNA
EUR 572

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7166306 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7166307 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7166308 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3373606 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3373607 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3373608 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2800605 3 x 1.0 ug
EUR 376

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2084906 1.0 ug DNA
EUR 167

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2084907 1.0 ug DNA
EUR 167

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2084908 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2800606 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2800607 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2800608 1.0 ug DNA
EUR 167

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV785496 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV785497 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV785498 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Multivariate strategies revealed noticeably divergent apportionment among the many poisonous/important parts in the cancerous sufferers than the wholesome counterparts. Overall, the research confirmed considerably divergent distribution and associations of the important and poisonous elemental ranges in the serum of the CRC sufferers in comparability with the wholesome donors.