Bovine serum albumin/chitosan-nanoparticle bio-complex; spectroscopic study and in vivo toxicological - Hypersensitivity evaluation

Bovine serum albumin/chitosan-nanoparticle bio-complex; spectroscopic study and in vivo toxicological – Hypersensitivity evaluation

This study, investigates the interplay of bovine serum albumin (BSA) with synthesized chitosan nanoparticles (CSNPs) utilizing regular-state fluorescence and UV-vis absorbance spectroscopy in addition to picosecond time-resolved fluorescence approach. The fluorescence quenching mechanism of BSA by CSNPs signifies the presence of each static and dynamic mechanism.
The loading effectivity of BSA-CSNPs exhibited a lower by about 6% in impartial pH underneath physiological temperature. Transmission electron microcopy (TEM) photographs revealed the Synthesized CSNPs have been irregular in form with measurement of ~42 nm.
The security and biocompatibility of BSA-CSNPs contained in the physique was investigated after intraperitoneal (IP) injection of male mice for 9 days, evaluation of in vivo outcomes, revealed no toxicity with a hypocholesterolemic impact and a predicted gentle activation of WBCs as a result of CSNPs adjuvant and immunogenic peptides in BSA. Accordingly, no indicators of hypersensitivity have been noticed as a result of administration of such formulations. The outcomes can be utilized for a greater understanding the interplay of CSNPs inside organic protein setting.

Development of a LC-MS/MS methodology to measure serum 3-sulfate and 3-glucuronide 25-hydroxyvitamin D3 metabolites; comparisons to unconjugated 25OHD in being pregnant and polycystic ovary syndrome

Vitamin D standing is routinely assessed by measuring circulating concentrations of 25-hydroxyvitamin D (25OHD2 or 25OHD3). However as deconjugation isn’t routinely integrated into pattern remedy previous to evaluation, conjugated types of 25OHD (significantly the extra plentiful 25OHD3) are sometimes not thought of in figuring out serum concentrations of complete 25OHD.
Two main circulating conjugated types of 25OHD3 are 25-hydroxyvitamin D3-3-sulfate (25OHD3-S) and 25-hydroxyvitamin D3-3-glucuronide (25OHD3-G). Incorporating these two conjugated metabolites into the measurement of vitamin D standing may enhance our understanding of vitamin D standing in well being, significantly if there are modifications in sulfation and glucuronidation actions.
The purpose of this study was to develop a liquid chromatography tandem-mass spectrometry (LC-MS/MS) focused methodology for measurement of 25OHD3-S and 25OHD3-G in serum to allow comparisons with circulating ranges of the free 25OHD3 type. We developed and validated a brand new LC-MS/MS methodology that measured each 25OHD3-S and 25OHD3-G following a strong section extraction pattern preparation methodology.
Partial separation of analytes by LC, and the separation of analytes by the optimized a number of response monitoring transitions enabled the quantitation of each 25OHD3-S and 25OHD3-G in the one methodology. Serum concentrations of 25OHD3-S (24.7 ± 11.eight ng/mL) and 25OHD3-G (2.4 ± 1.2 ng/mL) have been proven to be a major proportion of circulating vitamin D metabolites in wholesome donor serums. These ranges of 25OHD3-S and 25OHD3-G intently related to 25OHD3 concentrations, r=0.728, p=0.001 and r=0.632, p=0.006 respectively.
However in serum from pregnant ladies and non-pregnant ladies with polycystic ovary syndrome (PCOS) vital variations in the ratios between conjugated and free 25OHD3 have been noticed between being pregnant teams (25OHD3/25OHD3-S and 25OHD3/25OHD3-G p<0.001), and between wholesome and PCOS topics (25OHD3/25OHD3-G p<0.050).
Development of this novel excessive-throughput LC-MS/MS methodology signifies that 25OHD3-S and 25OHD3-G are substantial parts of circulating vitamin D metabolites. The concentrations of those metabolites relative to standard 25OHD3 could fluctuate in completely different physiological and pathophysiological settings, and could subsequently play an unrecognized however vital function in the actions of vitamin D.

Low serum levels of cholesterol predict inferior prognosis and enhance prognostic index scoring for peripheral T-cell lymphoma, unspecified

Peripheral T-cell lymphomas, unspecified (PTCL-U) is a heterogeneous group of non-Hodgkin lymphomas, arising from the transformation of mature, put up-thymic T-cells. Prognostic index for PTCL-U (PIT) is predicated on Europeans and might not be relevant for Chinese PTCL-U sufferers. Besides, low circulating ldl cholesterol focus is related to elevated most cancers incidence and mortality.
The objective of our study was to evaluate the prognostic worth of serum lipid ranges in PTCL-U and enhance PIT. We screened the prognostic elements related to development-free survival (PFS) and general survival (OS) by multivariate Cox regression evaluation in ninety-one enrolled sufferers. The outcomes confirmed that low-stage excessive-density lipoprotein ldl cholesterol (HDL-C) and low-density lipoprotein ldl cholesterol (LDL-C) have been related to unfavorable OS. Furthermore, we developed a brand new danger mannequin, PITC, based mostly on low-stage HDL-C, LDL-C and PIT. In Chinese PTCL-U, PITC was superior to PIT in PFS and OS. In conclusion, serum levels of cholesterol could also be good candidates for predicting prognosis in PTCL-U.

Profiling of Serum Exosome MiRNA Reveals the Potential of a MiRNA Panel as Diagnostic Biomarker for Alzheimer’s Disease

Alzheimer’s illness (AD) is the most typical neurodegenerative illness in the older adults. Although a lot effort has been made in the analyses of diagnostic biomarkers, reminiscent of amyloid-β, tau, and neurofilament mild chain, figuring out peripheral blood-based mostly biomarkers is in extraordinarily pressing want for his or her minimal invasiveness and extra comfort.
Bovine serum albumin/chitosan-nanoparticle bio-complex; spectroscopic study and in vivo toxicological - Hypersensitivity evaluation
Here we characterised the miRNA profile by RNA sequencing in human serum exosomes from AD sufferers and wholesome controls (HC) to analyze its potential for AD analysis. Subsequently, Gene Ontology evaluation and pathway evaluation have been carried out for the focused genes from the differentially expressed miRNAs. These fundamental capabilities have been differentially enriched, together with cell adhesion, regulation of transcription, and the ubiquitin system.
Functional community evaluation highlighted the pathways of proteoglycans in most cancers, viral carcinogenesis, signaling pathways regulating pluripotency of stem cells, and mobile senescence in AD. A complete of 24 miRNAs confirmed considerably differential expression between AD and HC with greater than ± 2.0-fold change at p worth < 0.05 and at the very least 50 reads for every pattern. Logistic regression evaluation established a mannequin for AD prediction by serum exosomal miR-30b-5p, miR-22-3p, and miR-378a-3p.

Human Serum (FABP free)

90R-109 100 ml
EUR 1105
Description: FABP free normal human serum

Human Serum (Myoglobin Free)

90R-110 100 ml
EUR 1105
Description: Myoglobin free normal human serum


13-410-CV 500 mL/pk
EUR 124
Description: Specialty Media; Insect Media Products

VitroPlus III, Serum-Free, Xeno-Free, Complete

PC00B2 500 ml
EUR 375

EZ-DNA Reagents

SK8201 100preps
EUR 93.5
  • Product category: Molecular Biology Kits/DNA - Extraction (Genomic)/Multipurpose

EZ-DNA Reagents

BS8202 100preps
EUR 88.06
  • Product category: Molecular Biology Kits/DNA - Extraction (Genomic)/Multipurpose

Bovine Serum Albumin, protease free

GK4012-1KG 1 kg
EUR 971

Bovine Serum Albumin, protease free

GK4012-500G 500 g
EUR 532

Serum Albumin, Lipid Free Protein

  • EUR 773.00
  • EUR 286.00
  • EUR 523.00
  • 100 mg
  • 10 mg
  • 50 mg
  • Shipped within 5-10 working days.

Human Serum (Troponin I Free)

90R-106 100 ml
EUR 1181
Description: Troponion I free normal human serum

PK15 Cell Serum-Free Medium

VCum-Lsx0007 1 L
EUR 758
Description: PK15 cell serum-free medium has been specifically developed for suspension culture of PK-15 cells.

CHO Cell Serum-Free Medium

VCum-Lsx0025 1L
EUR 635
Description: A serum-free medium that is ideal for suspension culture of CHO cell lines (CHO DG44, CHO-K1 and CHO-S).

HEK Cell Serum-Free Medium

VCum-Lsx0027 1L
EUR 635
Description: A serum-free medium that is ideal for suspension culture of HEK cell lines.

MDBK Cell Serum-Free Medium

VCum-Lsx0029 1L
EUR 682
Description: Used in serum-free suspension MDBK cell line culture for bovine virus diarrhea or bovine rhinotracheitis vaccine production.

Vero Cell Serum-Free Medium

VCum-Lsx0031 1 L
EUR 758
Description: A serum-free medium that is ideal for suspension culture of Vero cell lines.

Human Free PSA (f-PSA) ELISA Kit

PRB-5049-FREE-5 5 x 96 assays
EUR 2283

Bovine Serum Albumin, fatty acid free

GX5685-1KG 1 kg
EUR 1202

Bovine Serum Albumin, fatty acid free

GX5685-500G 500 g
EUR 660

Fetal Bovine Serum, Premium Tetracyclin Free

F0500-050 500ml
EUR 1157

B-27 Serum-Free Supplement (50x)

abx082466-10ml 10 ml
EUR 328
  • Shipped within 5-10 working days.


88-551-CM 1/pk
EUR 149
Description: Specialty Media; Kohjin Products


88-581-CM 1/pk
EUR 189
Description: Specialty Media; Kohjin Products

Normal Bovine Serum (Protease/IgG free)

88R-1012 10 ml
EUR 182
Description: Normal Bovine Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

ST Cell Serum-Free Medium-1

VCum-Lsx0001 1 L
EUR 740
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

ST Cell Serum-Free Medium-2

VCum-Lsx0003 1 L
EUR 758
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

PK15 Cell Serum-Free Medium (Powder)

VCum-Lsx0008-10L 10 L
EUR 2332
Description: PK15 cell serum-free medium has been specifically developed for suspension culture of PK-15 cells.

PK15 Cell Serum-Free Medium (Powder)

VCum-Lsx0008-1L 1 L
EUR 278
Description: PK15 cell serum-free medium has been specifically developed for suspension culture of PK-15 cells.

PK15 Cell Serum-Free Medium (Powder)

VCum-Lsx0008-5L 5 L
EUR 1191
Description: PK15 cell serum-free medium has been specifically developed for suspension culture of PK-15 cells.

MDCK Cell Serum-Free Medium-1

VCum-Lsx0009 1 L
EUR 682
Description: MDCK cell serum-free medium has been specifically developed for suspension culture of MDCK cells.

MDCK Cell Serum-Free Medium-2

VCum-Lsx0011 1 L
EUR 694
Description: Used in serum-free suspension MDCK cell line culture for avian influenza vaccine production.

BHK Cell Serum-Free Medium-1

VCum-Lsx0017 1 L
EUR 647
Description: BHK cell serum-free medium has been specifically developed for suspension culture of BHK cells.

BHK Cell Serum-Free Medium-2

VCum-Lsx0019 1 L
EUR 717
Description: Used in serum-free suspension BHK cell line culture for newcastle disease virus production.

Insect Cell Serum-Free Medium-1

VCum-Lsx0021 1 L
EUR 740
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Insect Cell Serum-Free Medium-2

VCum-Lsx0023 1 L
EUR 758
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

CHO Cell Serum-Free Medium (Powder)

VCum-Lsx0026-10L 10 L
EUR 1747
Description: A serum-free medium that is ideal for suspension culture of CHO cell lines (CHO DG44, CHO-K1 and CHO-S).

CHO Cell Serum-Free Medium (Powder)

VCum-Lsx0026-1L 1 L
EUR 220
Description: A serum-free medium that is ideal for suspension culture of CHO cell lines (CHO DG44, CHO-K1 and CHO-S).

CHO Cell Serum-Free Medium (Powder)

VCum-Lsx0026-5L 5 L
EUR 898
Description: A serum-free medium that is ideal for suspension culture of CHO cell lines (CHO DG44, CHO-K1 and CHO-S).

HEK Cell Serum-Free Medium (Powder)

VCum-Lsx0028 50 L
EUR 6411
Description: A serum-free medium that is ideal for suspension culture of HEK cell lines.

MDBK Cell Serum-Free Medium (Powder)

VCum-Lsx0030 50 L
EUR 8591
Description: Used in serum-free suspension MDBK cell line culture for bovine virus diarrhea or bovine rhinotracheitis vaccine production.

Vero Cell Serum-Free Medium (Powder)

VCum-Lsx0032-10L 10 L
EUR 2332
Description: A serum-free medium that is ideal for suspension culture of Vero cell lines.

Vero Cell Serum-Free Medium (Powder)

VCum-Lsx0032-1L 1 L
EUR 282
Description: A serum-free medium that is ideal for suspension culture of Vero cell lines.

Vero Cell Serum-Free Medium (Powder)

VCum-Lsx0032-5L 5 L
EUR 1208
Description: A serum-free medium that is ideal for suspension culture of Vero cell lines.

Set of 10 Biolipidure Reagents

Biolipidure-set 10mLx10
EUR 1517
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: Set of 10 Biolipidure Reagents, whose applications include Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Human Apolipoprotein AI / B Free Serum Protein

abx060869-100ml 100 ml
EUR 495
  • Shipped within 5-10 working days.

ST Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0002-10L 10 L
EUR 2215
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

ST Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0002-1L 1 L
EUR 266
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

ST Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0002-5L 5 L
EUR 1132
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

ST Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0004-10L 10 L
EUR 2332
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

ST Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0004-1L 1 L
EUR 278
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

ST Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0004-5L 5 L
EUR 1191
Description: ST cell serum-free medium has been specifically developed for suspension culture of ST cells.

MDCK Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0010-10L 10 L
EUR 1864
Description: MDCK cell serum-free medium has been specifically developed for suspension culture of MDCK cells.

MDCK Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0010-1L 1 L
EUR 231
Description: MDCK cell serum-free medium has been specifically developed for suspension culture of MDCK cells.

MDCK Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0010-5L 5 L
EUR 957
Description: MDCK cell serum-free medium has been specifically developed for suspension culture of MDCK cells.

MDCK Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0012-10L 10 L
EUR 1922
Description: Used in serum-free suspension MDCK cell line culture for avian influenza vaccine production.

MDCK Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0012-1L 1 L
EUR 237
Description: Used in serum-free suspension MDCK cell line culture for avian influenza vaccine production.

MDCK Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0012-5L 5 L
EUR 986
Description: Used in serum-free suspension MDCK cell line culture for avian influenza vaccine production.

BHK Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0018-10L 10 L
EUR 1688
Description: BHK cellserum-free medium has been specifically developed for suspension culture of BHK cells.

BHK Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0018-1L 1 L
EUR 214
Description: BHK cellserum-free medium has been specifically developed for suspension culture of BHK cells.

BHK Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0018-5L 5 L
EUR 869
Description: BHK cellserum-free medium has been specifically developed for suspension culture of BHK cells.

BHK Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0020-10L 10 L
EUR 1922
Description: Used in serum-free suspension BHK cell line culture for newcastle disease virus production.

BHK Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0020-1L 1 L
EUR 237
Description: Used in serum-free suspension BHK cell line culture for newcastle disease virus production.

BHK Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0020-5L 5 L
EUR 986
Description: Used in serum-free suspension BHK cell line culture for newcastle disease virus production.

Insect Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0022-10L 10 L
EUR 2215
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Insect Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0022-1L 1 L
EUR 266
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Insect Cell Serum-Free Medium-1 (Powder)

VCum-Lsx0022-5L 5 L
EUR 1132
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Insect Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0024-10L 10 L
EUR 2332
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Insect Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0024-1L 1 L
EUR 278
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Insect Cell Serum-Free Medium-2 (Powder)

VCum-Lsx0024-5L 5 L
EUR 1191
Description: A serum-free medium that is ideal for suspension culture of insect cell lines (HighFive, SF9).

Exo-Flow 2.0 Basic Kit without antibody (Streptavidin beads + reagents) - for Serum or Plasma

EUR 1001
  • Category: Exosome

Bradford(Coomassie) Protein Assay Plus Reagents

P7201-050 450ml
EUR 188

Bovine serum albumin (BSA) protein (>99%, Protease-free)

BSA16-N-100 100 mg
EUR 286

Insect Cell Medium: Serum-Free Insect Culture Medium

ABP-MED-10002 1 liter Ask for price
    • Product line: Cell Culture Reagents
    • Brand:

HSA Human Serum Albumin Recombinant Protein, Lipid Free

PROTP02768-3 Regular: 50mg
EUR 471
Description: HSA Human Recombinant lipid reduced produced in Plant is a non-glycosylated, polypeptide chain containing 585 amino acids and having a molecular mass of 67 kDa.


13-402-CV 500 mL/pk
EUR 153
Description: Specialty Media; Insect Media Products

Purified rat serum albumin protein (RSA, >99%, globulin free)

ALBR13-N-10 10 mg
EUR 286

Human Male AB Serum (Converted from Plasma), Xeno-Free

AR1005-0100 100mL Ask for price

Bovine Serum Albumin ? Heat Shock, Protease Free, pH 7.0

EUR 653

Bovine Serum Albumin ? Heat Shock, Protease Free, pH 7.0

EUR 245

Bovine Serum Albumin ? Heat Shock, Protease Free, pH 7.0

EUR 120

Rabbit control serum (non-immunized, Disease free, SPF Rabbits)

NSPF-1 1 ml
EUR 286

Rabbit control serum (non-immunized, Disease free, SPF Rabbits)

NSPF-10 10 ml
EUR 651

Rabbit control serum (non-immunized, Disease free, SPF Rabbits)

NSPF-5 5 ml
EUR 529

Mouse Serum

abx098261-100L 100 L
EUR 129506
  • Shipped within 5-10 working days.

Mouse Serum

  • EUR 1163.00
  • EUR 272.00
  • 100 ml
  • 10 ml
  • Shipped within 5-10 working days.

Mouse Serum

abx098261-5L 5 L
EUR 8833
  • Shipped within 5-10 working days.

Mouse Serum

abx098262-1ml 1 ml
EUR 1720
  • Shipped within 5-10 working days.

Bovine Serum Albumin ? Heat Shock, Protease DNASE Free, pH 7.0

EUR 914

Bovine Serum Albumin ? Heat Shock, Protease DNASE Free, pH 7.0

7920-1000 Ask for price

Bovine Serum Albumin ? Heat Shock, Protease DNASE Free, pH 7.0

EUR 370

Bovine Serum Albumin ? Heat Shock, Protease DNASE Free, pH 7.0

EUR 153

Bovine Serum Albumin ? Heat Shock, Fatty Acid Free, pH 7.0

EUR 1132

Bovine Serum Albumin ? Heat Shock, Fatty Acid Free, pH 7.0

EUR 446

Bovine Serum Albumin ? Heat Shock, Fatty Acid Free, pH 7.0

EUR 175

Human IgG (serum origin, purified >97%, low endotoxin, azide free)

20007-1-LE-1 1 mg
EUR 164

Normal Mouse Serum

88-NM35 50 ml
EUR 516
Description: Normal Mouse Serum

Normal Mouse Serum

88R-1002 5 ml
EUR 203
Description: Normal Mouse Serum which has been lipid extracted and dialyzed against 10 mM Sodium Phosphate, 0.15 M Sodium Chloride, pH 7.2

Mouse Serum Albumin

30R-3304 10 mg
EUR 187
Description: Purified native Mouse Serum Albumin

Mouse Complement Serum

32R-CM001 5 ml
EUR 435
Description: Frozen high activity mouse complement serum

Mouse Free Tri-iodothyronine, Free-T3 ELISA Kit

CSB-E05077m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Mouse Free Tri-iodothyronine, Free-T3 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Free Tri-iodothyronine, Free-T3 ELISA Kit

  • EUR 500.00
  • EUR 3402.00
  • EUR 1820.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative competitive ELISA kit for measuring Mouse Free Tri-iodothyronine, Free-T3 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Male AB Serum (Converted from Plasma), Xeno-Free Heat Inactivated

AR1006-0100 100mL Ask for price

Bovine Serum Albumin ? Cohn Fraction V, Fatty Acid Free, pH ? 7.0

EUR 653

Bovine Serum Albumin ? Cohn Fraction V, Fatty Acid Free, pH ? 7.0

EUR 245

Bovine Serum Albumin ? Cohn Fraction V, Fatty Acid Free, pH ? 7.0

EUR 120

Bovine Serum Albumin ? Cohn Fraction V, Fatty Acid Free, pH ? 5.2

EUR 653

Bovine Serum Albumin ? Cohn Fraction V, Fatty Acid Free, pH ? 5.2

EUR 245

Bovine Serum Albumin ? Cohn Fraction V, Fatty Acid Free, pH ? 5.2

EUR 120

Human IgG-Biotin (serum origin, purified >97%, low endotoxin, azide free)

20007-1-LE-BTN 100 ug
EUR 286

Mouse Free Tri-iodothyronine Indes(Free-T3)ELISA Kit

GA-E0078MS-48T 48T
EUR 336

Mouse Free Tri-iodothyronine Indes(Free-T3)ELISA Kit

GA-E0078MS-96T 96T
EUR 534

Mouse Free Tri-iodothyronine Indes,Free-T3 ELISA Kit

CN-02860M1 96T
EUR 476

Mouse Free Tri-iodothyronine Indes,Free-T3 ELISA Kit

CN-02860M2 48T
EUR 326

Mouse Free Tri-iodothyronine Indes(Free-T3)ELISA Kit

QY-E20615 96T
EUR 361

IPTG, Animal-Free (Dioxane-Free)

EUR 115

IPTG, Animal-Free (Dioxane-Free)

EUR 985

IPTG, Animal-Free (Dioxane-Free)

EUR 218

Mouse Serum Amyloid P Component (SAP) Reference serum

SAP12-RS 100 ul
EUR 324

Purified rat serum albumin protein (RSA, >99%, fatty acid and globulin free)

ALBR14-N-10 10 mg
EUR 347

Bovine Serum Albumin ? Cohn Fraction V, Immunoassay Grade, Protease Free, pH ? 7.0

EUR 653

Bovine Serum Albumin ? Cohn Fraction V, Immunoassay Grade, Protease Free, pH ? 7.0

EUR 245

Bovine Serum Albumin ? Cohn Fraction V, Immunoassay Grade, Protease Free, pH ? 7.0

EUR 120

Bovine Serum Albumin ? Cohn Fraction V, Immunoassay Grade, Protease Free, pH ? 5.2

EUR 653

Bovine Serum Albumin ? Cohn Fraction V, Immunoassay Grade, Protease Free, pH ? 5.2

EUR 245

Bovine Serum Albumin ? Cohn Fraction V, Immunoassay Grade, Protease Free, pH ? 5.2

EUR 120

Mouse Serum Albumin Protein

  • EUR 926.00
  • EUR 314.00
  • EUR 3975.00
  • EUR 244.00
  • 100 mg
  • 10 mg
  • 1 g
  • 1 mg
  • Shipped within 1 month.

Mouse Serum Albumin antibody

70R-AG001 1 mg
EUR 256
Description: Affinity purified Goat polyclonal Mouse Serum Albumin antibody

Mouse Serum Albumin protein

30-1179 10 mg
EUR 236
Description: Purified native Mouse Albumin protein

Mouse Serum Albumin antibody

20R-AR005 20 mg
EUR 327
Description: Rabbit polyclonal Mouse Serum Albumin antibody

Mouse Serum albumin antibody

20R-AR041 2 ml
EUR 295
Description: Rabbit polyclonal Mouse Serum albumin antibody

Mouse Serum albumin (Alb)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serum albumin(Alb) expressed in Yeast

Mouse Serum albumin (Alb)

  • EUR 840.00
  • EUR 332.00
  • EUR 2170.00
  • EUR 1135.00
  • EUR 1579.00
  • EUR 470.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serum albumin(Alb) expressed in Baculovirus

Non-sterile mouse serum

MS05-0050 50 ml
EUR 231.4
  • Non-sterile mouse serum is indicated as RUO. Do not use on humans.

Non-sterile mouse serum

MS05-0100 100 ml
EUR 257.4
  • Non-sterile mouse serum is indicated as RUO. Do not use on humans.

Non-sterile mouse serum

MS05-0500 500 ml
EUR 440.7
  • Non-sterile mouse serum is indicated as RUO. Do not use on humans.

Block-Free ELISA Reagent (Protein-Free)

EUR 457

Block-Free ELISA Reagent (Protein-Free)

EUR 153

Mouse Testosterone, Free ELISA kit

E03T0561-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testosterone, Free in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Testosterone, Free ELISA kit

E03T0561-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testosterone, Free in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Testosterone, Free ELISA kit

E03T0561-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Testosterone, Free in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free cholesterol ELISA kit

E03F0212-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Free cholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free cholesterol ELISA kit

E03F0212-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Free cholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free cholesterol ELISA kit

E03F0212-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Free cholesterol in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free haemoglobin ELISA kit

E03F0223-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Free haemoglobin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free haemoglobin ELISA kit

E03F0223-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Free haemoglobin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free haemoglobin ELISA kit

E03F0223-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Free haemoglobin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free calcium ELISA kit

E03F0272-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Free calcium in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free calcium ELISA kit

E03F0272-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Free calcium in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free calcium ELISA kit

E03F0272-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Free calcium in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose,Free ELISA kit

E03G0030-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose,Free in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose,Free ELISA kit

E03G0030-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose,Free in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glucose,Free ELISA kit

E03G0030-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glucose,Free in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Free-T3 ELISA Kit

EMF0254 96Tests
EUR 521

Mouse IgG (Azide free) Protein

abx160024-002g 0.02 g
EUR 286
  • Shipped within 5-10 working days.

Mouse Free Thyroxine ELISA kit

55R-2028 96 tests
EUR 617
Description: ELISA Kit for detection of Free Thyroxine in the research laboratory

Mouse Free Triiodothyronine ELISA kit

55R-2029 96 tests
EUR 617
Description: ELISA Kit for detection of Free Triiodothyronine in the research laboratory

Bovine serum albumin (BSA) protein (>99%, Protease & IgG-free; Low endotoxin; Diagnostic grade)

BSA17-N-100 100 mg
EUR 286

Bovine serum albumin (BSA) protein (>99%, Protease & IgG-free; Low endotoxin; Diagnostic grade)

BSA17-N-100G 100 g
EUR 834

Bovine serum albumin (BSA) protein (>99%, Protease & IgG-free; Low endotoxin; Diagnostic grade)

BSA17-N-10G 10 g
EUR 469

Bovine serum albumin (BSA) protein (>99%, Protease & IgG-free; Low endotoxin; Diagnostic grade)

BSA17-N-1G 1 g
EUR 529

Free-T3/ Rat Free- T3 ELISA Kit

ELA-E0450r 96 Tests
EUR 886

Mouse Serum Albumin ELISA kit

E03S0014-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum Albumin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum Albumin ELISA kit

E03S0014-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum Albumin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum Albumin ELISA kit

E03S0014-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum Albumin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum amyloid ELISA kit

E03S0228-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum amyloid in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum amyloid ELISA kit

E03S0228-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum amyloid in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum amyloid ELISA kit

E03S0228-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum amyloid in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum Iron ELISA kit

E03S0273-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum Iron in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum Iron ELISA kit

E03S0273-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum Iron in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum Iron ELISA kit

E03S0273-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Serum Iron in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Serum Albumin Polyclonal Antibody

A57545 100 µg
EUR 570.55
Description: fast delivery possible

Mouse Serum response factor (Srf)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serum response factor(Srf) expressed in E.coli

Mouse serum albumin lyophilized powder

MSA62-0050 50mg
EUR 370.5
  • Mouse serum albumin lyophilized powder is indicated as RUO. Do not use on humans.

Mouse serum albumin lyophilized powder

MSA62-0100 100mg
EUR 509.6
  • Mouse serum albumin lyophilized powder is indicated as RUO. Do not use on humans.

Mouse serum albumin lyophilized powder

MSA62-0500 500mg
EUR 1311.7
  • Mouse serum albumin lyophilized powder is indicated as RUO. Do not use on humans.

Mouse serum albumin lyophilized powder

MSA62-1000 1gm Ask for price
  • Mouse serum albumin lyophilized powder is indicated as RUO. Do not use on humans.

Mouse control serum, Balb/c

NMOS-5BS 5 ml
EUR 164

Mouse control serum, CD-1

NMOS-CD1-1 1 ml
EUR 103

Mouse control serum, CD-1

NMOS-CD1-5 5 ml
EUR 164

Resistin (mouse) Serum ELISA Kit

EUR 958

Bovine Serum Albumin (BSA, protease-free) for western (makes ~2-L buffer @5% BSA)

80400-100 100 g
EUR 202

Bovine Serum Albumin (BSA, protease-free) for western (makes ~10-L buffer @5% BSA)

80400-500 500 g
EUR 651

Equine Serum

EQS001 500 ml
EUR 200

Cow Serum

abx098251-100ml 100 ml
EUR 342
  • Shipped within 5-10 working days.

Fish Serum

abx098257-10ml 10 ml
EUR 439
  • Shipped within 5-10 working days.

Goat Serum

abx098258-500ml 500 ml
EUR 370
  • Shipped within 5-10 working days.

Goat Serum

abx098259-500ml 500 ml
EUR 370
  • Shipped within 5-10 working days.
Sequencing outcomes have been validated utilizing quantitative reverse transcription PCR. The knowledge confirmed that miR-30b-5p, miR-22-3p, and miR-378a-3p have been considerably deregulated in AD, with space underneath the curve (AUC) of 0.668, 0.637, and 0.718, respectively. The mixture of the three miRs gained a greater diagnostic functionality with AUC of 0.880. This discovering revealed a miR panel as potential biomarker in the peripheral blood to tell apart AD from HC.
Are CSF CXCL13 concentrations solely dependent on intrathecal production? A commentary on "Chemokine CXCL13 in serum, CSF, and blood-CSF barrier function"

Are CSF CXCL13 concentrations solely dependent on intrathecal production? A commentary on “Chemokine CXCL13 in serum, CSF, and blood-CSF barrier function”

Pilz et al. (Fluids Barriers CNS 17:7; 2020) investigated how CSF CXCL13 concentrations are influenced by CXCL13 serum concentrations and blood-CSF barrier (BCSFB) perform, evaluating the affect of serum CXCL13 ranges and Qalbumin (CSF albumin/serum albumin) on CSF CXCL13 amongst sufferers with CNS irritation categorized as CXCL13 unfavourable, low, medium, or excessive.
Among all CXCL13 teams, their outcomes confirmed no correlation between CSF CXCL13 concentrations and serum CXCL13 or Qalbumin. The authors argue that, in distinction to different proteins, CXCL13 passage throughout the BCSFB doesn’t happen, no matter BCSFB perform, and is as an alternative solely influenced by intrathecal manufacturing.
In distinction to the authors’ findings, in our research together with each non-inflammatory neurological issues (NIND; n = 62) and a number of sclerosis (MS) sufferers we noticed a big correlation between serum CXCL13 concentrations and CSF CXCL13 concentrations.
We evaluation a number of observations which can underlie these contrasting outcomes, together with (1) the affect of serum CXCL13 concentrations on CSF CXCL13 in sufferers with decrease intrathecal CXCL13 manufacturing and thus decrease CXCL13 concentrations (i.e. NIND and MS), (2) the proposed diffusion dynamics of the small molecule CXCL13 throughout the BCSFB, and (3) differing definitions of unfavourable versus elevated CSF CXCL13 concentrations decided by an assay’s relative sensitivity. In conclusion, we argue that for sufferers with reasonably elevated CSF CXCL13 concentrations, serum CXCL13 concentrations affect CSF CXCL13 ranges, and thus the suitable corrections together with incorporation of CSF/serum ratios and Qalbumin values must be utilized.

The Specific Judo Training Program Combined With the Whole Body Cryostimulation Induced an Increase of Serum Concentrations of Growth Factors and Changes in Amino Acid Profile in Professional Judokas

This research aimed to guage the impact of a selected coaching program, supported by 10 classes of complete physique cryostimulation, on progress elements concentrations, amino acids profile and motor skills in skilled judokas. Ultimately, twelve athletes took half in the research. They had been randomly assigned to the cryostimulation group (CRY, n = 6) or the management group (CON, n = 6). During 2 weeks of the judo coaching program, the CRY group carried out 10 cryo-sessions (3-min, at a temperature of -110°C) and the CON group rested passively.
Anthropometric measurements, a energy take a look at, the Special Judo Efficiency Test (SJET) had been assessed 2 days earlier than and after the judo coaching program. Blood samples had been collected at relaxation, 1 h after the primary and the second SJET and 1 h after the primary and the final cryo-session to ascertain progress elements and amino acid concentrations.
Lactate degree was measured earlier than, instantly after and 1 h after the primary and the second SJET. The utilized intervention resulted in a big improve of resting concentrations of brain-derived neurotrophic issue (from 10.23 ± 1.61 to 15.13 ± 2.93 ng⋅ml-1p = 0.01) and insulin-like progress issue 1 (IGF-1; from 174.29 ± 49.34 to 300.50 ± 43.80 pg⋅ml-1p = 0.00) in the CRY group.
Are CSF CXCL13 concentrations solely dependent on intrathecal production? A commentary on "Chemokine CXCL13 in serum, CSF, and blood-CSF barrier function"
A totally different response was registered 1 h immediately put up SJET in the CRY group (a big improve of IGF-1, interleukin 15 and irisin: p = 0.01; p = 0.00; p = 0.03). Additionally, the numerous drop of proline and leucine concentrations in the CRY group was obtained. Athletes’ efficiency remained unchanged in each teams. However, topics perceived constructive adjustments induced by the intervention – in a roundabout way after cryostimulation however in response to the particular coaching workload. The improve of progress elements concentrations and the advance of amino acid profile (proline and leucine) contributed to sustaining a excessive degree of muscle perform.

Multivariate Investigation of Toxic and Essential Metals in the Serum from Various Types and Stages of Colorectal Cancer Patients

Colorectal most cancers (CRC) is at the moment one of the crucial frequent malignant neoplasms, rating third in incidence and 2nd in mortality each in the USA and internationally. The pathogenesis of CRC is a posh interplay between genetic susceptibility and environmental elements resembling publicity to metals. Therefore, the current research was meant to evaluate the imbalances in the concentrations of chosen important/poisonous parts (Pb, Cr, Fe, Zn, As, Cd, Cu, Se, Ni, and Hg) in the serum of newly identified colorectal carcinoma sufferers (n = 165) in comparability with counterpart controls (n = 151) by atomic absorption spectrometry after wet-acid digestion technique.
Serum carcinoembryonic antigen (CEA) of the CRC sufferers was decided utilizing immunoradiometric technique. Body mass index (BMI) which is a longtime threat issue for CRC was additionally calculated for sufferers and wholesome controls. Conversely, common Ni (2.721 μg/g), Cd (0.563 μg/g), As (0.539 μg/g), and Pb (1.273 μg/g) ranges had been considerably elevated in the serum of CRC sufferers in comparison with the wholesome donors, whereas the typical Se (7.052 μg/g), Fe (15.67 μg/g), Cu (2.033 μg/g), and Zn (8.059 μg/g) concentrations had been elevated in controls.
The correlation coefficients between the weather in the cancerous sufferers demonstrated considerably dissimilar communal relationships in contrast with the wholesome topics. Significant variations in the basic ranges had been additionally confirmed for CRC varieties (major colorectal lymphoma, gastrointestinal stromal tumor, and adenocarcinoma) and CRC levels (stage-I, stage-II, stage-III, and stage-IV) among the many sufferers. Majority of the weather demonstrated perceptible disparities in their ranges based mostly on dietary, habitat, gender, and smoking habits of the malignant sufferers and wholesome topics.

SAA4 antibody

70R-5924 50 ug
EUR 467
Description: Rabbit polyclonal SAA4 antibody raised against the middle region of SAA4

SAA4 Antibody

ABD7899 100 ug
EUR 438

SAA4 Antibody

ABD8088 100 ug
EUR 438


E541-021 100ug
EUR 343

SAA4 Conjugated Antibody

C43534 100ul
EUR 397

SAA4 Polyclonal Antibody

ABP56119-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130

SAA4 Polyclonal Antibody

ABP56119-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130

SAA4 Polyclonal Antibody

ABP56119-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130

anti- SAA4 antibody

FNab07574 100µg
EUR 585
  • Immunogen: serum amyloid A4, constitutive
  • Uniprot ID: P35542
  • Gene ID: 6291
  • Research Area: Cardiovascular
Description: Antibody raised against SAA4

SAA4 Polyclonal Antibody

ES7118-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SAA4 from Human. This antibody is tested and validated for IHC, WB, ELISA

SAA4 Polyclonal Antibody

ES7118-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SAA4 from Human. This antibody is tested and validated for IHC, WB, ELISA

Anti-SAA4 antibody

PAab07574 100 ug
EUR 412

Anti-SAA4 antibody

STJ118868 100 µl
EUR 277

Anti-SAA4 antibody

STJ95571 200 µl
EUR 197
Description: Rabbit polyclonal to SAA4.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14502 50 ug
EUR 363
Description: Mouse polyclonal to SAA4


YF-PA14503 100 ul
EUR 403
Description: Rabbit polyclonal to SAA4


YF-PA14504 100 ug
EUR 403
Description: Rabbit polyclonal to SAA4


YF-PA24657 50 ul
EUR 334
Description: Mouse polyclonal to SAA4

SAA4 Blocking Peptide

33R-1030 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF20L1 antibody, catalog no. 70R-8973

SAA4 Blocking Peptide

33R-8261 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SAA4 antibody, catalog no. 70R-5922

SAA4 Blocking Peptide

DF7899-BP 1mg
EUR 195

Human SAA4 Protein

abx060004-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

SAA4 cloning plasmid

CSB-CL020659HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 393
  • Sequence: atgaggcttttcacaggcattgttttctgctccttggtcatgggagtcaccagtgaaagctggcgttcgtttttcaaggaggctctccaaggggttggggacatgggcagagcctattgggacataatgatatccaatcaccaaaattcaaacagatatctctatgctcggggaaa
  • Show more
Description: A cloning plasmid for the SAA4 gene.

SAA4 Rabbit pAb

A16428-100ul 100 ul
EUR 308

SAA4 Rabbit pAb

A16428-200ul 200 ul
EUR 459

SAA4 Rabbit pAb

A16428-20ul 20 ul
EUR 183

SAA4 Rabbit pAb

A16428-50ul 50 ul
EUR 223

Anti-SAA4 (3C11)

YF-MA15335 100 ug
EUR 363
Description: Mouse monoclonal to SAA4

Monoclonal SAA4 Antibody, Clone: EPR2926

AMR09806G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SAA4. The antibodies are raised in Rabbit and are from clone EPR2926. This antibody is applicable in WB and IHC

Polyclonal SAA4 Antibody (C-term)

AMR09807G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAA4 (C-term). This antibody is tested and proven to work in the following applications:

Anti-SAA4/Serum Amyloid A4 Antibody

A07115 100ul
EUR 397
Description: Rabbit Polyclonal SAA4/Serum Amyloid A4 Antibody. Validated in IHC and tested in Human.

Serum Amyloid A4, Constitutive (SAA4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serum Amyloid A4, Constitutive (SAA4) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Serum Amyloid A4, Constitutive (SAA4) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

SAA4 protein (His tag)

80R-1554 50 ug
EUR 397
Description: Purified recombinant Human SAA4 protein

Human SAA4 ELISA Kit

ELA-E10316h 96 Tests
EUR 824


EF002194 96 Tests
EUR 689

Mouse SAA4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SAA4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SAA4 Recombinant Protein (Human)

RP027541 100 ug Ask for price

SAA4 Recombinant Protein (Rat)

RP227402 100 ug Ask for price

SAA4 Recombinant Protein (Mouse)

RP169868 100 ug Ask for price

Human Serum Amyloid A-4 (SAA4) Antibody

13031-05011 150 ug
EUR 217

Serum Amyloid A-4 Protein (SAA4) Antibody

abx029249-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serum Amyloid A-4 Protein (SAA4) Antibody

abx029249-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serum Amyloid A-4 Protein (SAA4) Antibody

abx237574-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Serum amyloid A /SAA4/CSAA

E21-F15 10ug
EUR 343

Saa4 ORF Vector (Rat) (pORF)

ORF075802 1.0 ug DNA
EUR 506

SAA4 ORF Vector (Human) (pORF)

ORF009181 1.0 ug DNA
EUR 95

Saa4 ORF Vector (Mouse) (pORF)

ORF056624 1.0 ug DNA
EUR 506

SAA2-SAA4 Recombinant Protein (Human)

RP095754 100 ug Ask for price

SAA4 ELISA Kit (Human) (OKCD08499)

OKCD08499 96 Wells
EUR 975
Description: Description of target: SAA4 is a major acute phase reactant. It is an Apolipoprotein of the HDL complex.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

SAA4 ELISA Kit (Mouse) (OKEH05734)

OKEH05734 96 Wells
EUR 779
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

SAA4 ELISA Kit (Bovine) (OKEH07586)

OKEH07586 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

SAA4 ELISA Kit (Human) (OKEH02075)

OKEH02075 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Saa4 sgRNA CRISPR Lentivector set (Rat)

K7166301 3 x 1.0 ug
EUR 339

Saa4 sgRNA CRISPR Lentivector set (Mouse)

K3373601 3 x 1.0 ug
EUR 339

SAA4 sgRNA CRISPR Lentivector set (Human)

K2084901 3 x 1.0 ug
EUR 339

SAA2-SAA4 ORF Vector (Human) (pORF)

ORF031919 1.0 ug DNA Ask for price

Recombinant Serum Amyloid A4, Constitutive (SAA4)

  • EUR 496.03
  • EUR 236.00
  • EUR 1585.12
  • EUR 595.04
  • EUR 1090.08
  • EUR 395.00
  • EUR 3812.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35542
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.2kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Serum Amyloid A4, Constitutive expressed in: E.coli

Human Serum Amyloid A-4 (SAA4) Antibody (Biotin Conjugate)

13031-05021 150 ug
EUR 276

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4)

Human Serum Amyloid A4, Constitutive (SAA4) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2138.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Saa4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7166302 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7166303 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7166304 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3373602 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3373603 1.0 ug DNA
EUR 154

Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3373604 1.0 ug DNA
EUR 154

SAA2-SAA4 sgRNA CRISPR Lentivector set (Human)

K2800601 3 x 1.0 ug
EUR 339

SAA4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2084902 1.0 ug DNA
EUR 154

SAA4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2084903 1.0 ug DNA
EUR 154

SAA4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2084904 1.0 ug DNA
EUR 154

SAA4 Serum Amyloid A4 Human Recombinant Protein

PROTP35542 Regular: 10ug
EUR 317
Description: SAA4 Human Recombinant fused with a 21 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 131 amino acids (21-130 a.a.) and having a molecular mass of 14.9kDa. The SAA4 is purified by proprietary chromatographic techniques.

SAA4 Protein Vector (Rat) (pPB-C-His)

PV303206 500 ng
EUR 603

SAA4 Protein Vector (Rat) (pPB-N-His)

PV303207 500 ng
EUR 603

SAA4 Protein Vector (Rat) (pPM-C-HA)

PV303208 500 ng
EUR 603

SAA4 Protein Vector (Rat) (pPM-C-His)

PV303209 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPB-C-His)

PV226494 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPB-N-His)

PV226495 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPM-C-HA)

PV226496 500 ng
EUR 603

SAA4 Protein Vector (Mouse) (pPM-C-His)

PV226497 500 ng
EUR 603

SAA4 Protein Vector (Human) (pPB-C-His)

PV036721 500 ng
EUR 329

SAA4 Protein Vector (Human) (pPB-N-His)

PV036722 500 ng
EUR 329

SAA4 Protein Vector (Human) (pPM-C-HA)

PV036723 500 ng
EUR 329

SAA4 Protein Vector (Human) (pPM-C-His)

PV036724 500 ng
EUR 329

Recombinant Human SAA4 Protein, His, E.coli-10ug

QP13410-10ug 10ug
EUR 201

Recombinant Human SAA4 Protein, His, E.coli-1mg

QP13410-1mg 1mg
EUR 5251

Recombinant Human SAA4 Protein, His, E.coli-2ug

QP13410-2ug 2ug
EUR 155

Saa4 3'UTR Luciferase Stable Cell Line

TU118311 1.0 ml Ask for price

Saa4 3'UTR GFP Stable Cell Line

TU168311 1.0 ml Ask for price

Saa4 3'UTR Luciferase Stable Cell Line

TU219889 1.0 ml Ask for price

Saa4 3'UTR GFP Stable Cell Line

TU269889 1.0 ml Ask for price

SAA4 3'UTR GFP Stable Cell Line

TU072548 1.0 ml
EUR 1394

SAA4 3'UTR Luciferase Stable Cell Line

TU022548 1.0 ml
EUR 1394

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (FITC Conjugate)

13031-05041 150 ug
EUR 428

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (RPE Conjugate)

13031-05051 150 ug
EUR 428

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (APC Conjugate)

13031-05061 150 ug
EUR 428

Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (PerCP Conjugate)

13031-05071 150 ug
EUR 471

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with APC.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with Biotin.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with Cy3.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with FITC.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with HRP.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with PE.

ELISA kit for Human SAA4 (Serum Amyloid A4)

E-EL-H5638 1 plate of 96 wells
EUR 534
  • Gentaur's SAA4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SAA4. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SAA4 (Serum Amyloid A4) in samples from Serum, Plasma, Cell supernatant

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Recombinant Human Serum Amyloid A4/SAA4 (C-6His)

CF15-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0.

Human Serum Amyloid A4, Constitutive (SAA4) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Serum Amyloid A-4 Protein (SAA4) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV648229 1.0 ug DNA
EUR 514

SAA4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV648233 1.0 ug DNA
EUR 514

SAA4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV648234 1.0 ug DNA
EUR 514

SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 1)

K2800602 1.0 ug DNA
EUR 154

SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 2)

K2800603 1.0 ug DNA
EUR 154

SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 3)

K2800604 1.0 ug DNA
EUR 154

SAA2-SAA4 Protein Vector (Human) (pPB-C-His)

PV127674 500 ng Ask for price

SAA2-SAA4 Protein Vector (Human) (pPB-N-His)

PV127675 500 ng Ask for price

SAA2-SAA4 Protein Vector (Human) (pPM-C-HA)

PV127676 500 ng Ask for price

SAA2-SAA4 Protein Vector (Human) (pPM-C-His)

PV127677 500 ng Ask for price

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

SED529Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids.

Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Serum Amyloid A4, Constitutive elisa. Alternative names of the recognized antigen: C-SAA
  • CSAA
  • SA-A4
  • Constitutively expressed serum amyloid A protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Serum Amyloid A4, Constitutive (SAA4) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SAA4 (Glu19~Tyr130)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with APC-Cy7.

Human Serum amyloid A-4 protein(SAA4) ELISA kit

CSB-EL020659HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serum amyloid A-4 protein (SAA4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Serum amyloid A-4 protein(SAA4) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Serum amyloid A-4 protein(SAA4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Serum amyloid A-4 protein (SAA4) ELISA Kit

abx250406-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Saa4/ Serum amyloid A-4 protein ELISA Kit

E1304Mo 1 Kit
EUR 632

Human SAA4/ Serum amyloid A-4 protein ELISA Kit

E2208Hu 1 Kit
EUR 605

Human SAA4(Serum amyloid A-4 protein) ELISA Kit

EH1155 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: P35542
  • Alias: SAA4(Serum amyloid A-4 protein)/CSAA/C-SAA/Constitutively expressed serum amyloid A protein/SAA5/serum amyloid A4, constitutive
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Bovine Serum amyloid A- 4 protein, SAA4 ELISA KIT

ELI-20131b 96 Tests
EUR 928

Human Serum amyloid A- 4 protein, SAA4 ELISA KIT

ELI-21759h 96 Tests
EUR 824

ELISA kit for Human SAA4 (Serum Amyloid A4, Constitutive)

ELK4953 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serum Amyloid A4, Constitutive (SAA4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Serum Amyloid A4, Constitutive from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Cow Serum amyloid A-4 protein (SAA4) ELISA Kit

abx514753-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Serum amyloid A-4 protein (SAA4) ELISA Kit

abx514754-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Mouse Serum amyloid A-4 protein (SAA4) ELISA Kit

abx514755-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Serum amyloid A- 4 protein, Saa4 ELISA KIT

ELI-40813m 96 Tests
EUR 865

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV785495 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV785499 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV785500 1.0 ug DNA Ask for price

ELISA kit for Human Serum amyloid A-4 protein (SAA4)

KTE60753-48T 48T
EUR 332
  • Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serum amyloid A-4 protein (SAA4)

KTE60753-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serum amyloid A-4 protein (SAA4)

KTE60753-96T 96T
EUR 539
  • Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7166305 3 x 1.0 ug
EUR 376

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3373605 3 x 1.0 ug
EUR 376

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2084905 3 x 1.0 ug
EUR 376

Saa4 ELISA Kit| Mouse Serum amyloid A-4 protein ELISA Kit

EF016185 96 Tests
EUR 689

SAA4 ELISA Kit| Bovine Serum amyloid A-4 protein ELISA Kit

EF011896 96 Tests
EUR 689

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV648230 1.0 ug DNA
EUR 514

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV648231 1.0 ug DNA
EUR 572

SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV648232 1.0 ug DNA
EUR 572

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7166306 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7166307 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7166308 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3373606 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3373607 1.0 ug DNA
EUR 167

Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3373608 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2800605 3 x 1.0 ug
EUR 376

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2084906 1.0 ug DNA
EUR 167

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2084907 1.0 ug DNA
EUR 167

SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2084908 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2800606 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2800607 1.0 ug DNA
EUR 167

SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2800608 1.0 ug DNA
EUR 167

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV785496 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV785497 1.0 ug DNA Ask for price

SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV785498 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551