Pilz et al. (Fluids Barriers CNS 17:7; 2020) investigated how CSF CXCL13 concentrations are influenced by CXCL13 serum concentrations and blood-CSF barrier (BCSFB) perform, evaluating the affect of serum CXCL13 ranges and Qalbumin (CSF albumin/serum albumin) on CSF CXCL13 amongst sufferers with CNS irritation categorized as CXCL13 unfavourable, low, medium, or excessive.
Among all CXCL13 teams, their outcomes confirmed no correlation between CSF CXCL13 concentrations and serum CXCL13 or Qalbumin. The authors argue that, in distinction to different proteins, CXCL13 passage throughout the BCSFB doesn’t happen, no matter BCSFB perform, and is as an alternative solely influenced by intrathecal manufacturing.
In distinction to the authors’ findings, in our research together with each non-inflammatory neurological issues (NIND; n = 62) and a number of sclerosis (MS) sufferers we noticed a big correlation between serum CXCL13 concentrations and CSF CXCL13 concentrations.
We evaluation a number of observations which can underlie these contrasting outcomes, together with (1) the affect of serum CXCL13 concentrations on CSF CXCL13 in sufferers with decrease intrathecal CXCL13 manufacturing and thus decrease CXCL13 concentrations (i.e. NIND and MS), (2) the proposed diffusion dynamics of the small molecule CXCL13 throughout the BCSFB, and (3) differing definitions of unfavourable versus elevated CSF CXCL13 concentrations decided by an assay’s relative sensitivity. In conclusion, we argue that for sufferers with reasonably elevated CSF CXCL13 concentrations, serum CXCL13 concentrations affect CSF CXCL13 ranges, and thus the suitable corrections together with incorporation of CSF/serum ratios and Qalbumin values must be utilized.
The Specific Judo Training Program Combined With the Whole Body Cryostimulation Induced an Increase of Serum Concentrations of Growth Factors and Changes in Amino Acid Profile in Professional Judokas
This research aimed to guage the impact of a selected coaching program, supported by 10 classes of complete physique cryostimulation, on progress elements concentrations, amino acids profile and motor skills in skilled judokas. Ultimately, twelve athletes took half in the research. They had been randomly assigned to the cryostimulation group (CRY, n = 6) or the management group (CON, n = 6). During 2 weeks of the judo coaching program, the CRY group carried out 10 cryo-sessions (3-min, at a temperature of -110°C) and the CON group rested passively.
Anthropometric measurements, a energy take a look at, the Special Judo Efficiency Test (SJET) had been assessed 2 days earlier than and after the judo coaching program. Blood samples had been collected at relaxation, 1 h after the primary and the second SJET and 1 h after the primary and the final cryo-session to ascertain progress elements and amino acid concentrations.
Lactate degree was measured earlier than, instantly after and 1 h after the primary and the second SJET. The utilized intervention resulted in a big improve of resting concentrations of brain-derived neurotrophic issue (from 10.23 ± 1.61 to 15.13 ± 2.93 ng⋅ml-1; p = 0.01) and insulin-like progress issue 1 (IGF-1; from 174.29 ± 49.34 to 300.50 ± 43.80 pg⋅ml-1; p = 0.00) in the CRY group.
A totally different response was registered 1 h immediately put up SJET in the CRY group (a big improve of IGF-1, interleukin 15 and irisin: p = 0.01; p = 0.00; p = 0.03). Additionally, the numerous drop of proline and leucine concentrations in the CRY group was obtained. Athletes’ efficiency remained unchanged in each teams. However, topics perceived constructive adjustments induced by the intervention – in a roundabout way after cryostimulation however in response to the particular coaching workload. The improve of progress elements concentrations and the advance of amino acid profile (proline and leucine) contributed to sustaining a excessive degree of muscle perform.
Multivariate Investigation of Toxic and Essential Metals in the Serum from Various Types and Stages of Colorectal Cancer Patients
Colorectal most cancers (CRC) is at the moment one of the crucial frequent malignant neoplasms, rating third in incidence and 2nd in mortality each in the USA and internationally. The pathogenesis of CRC is a posh interplay between genetic susceptibility and environmental elements resembling publicity to metals. Therefore, the current research was meant to evaluate the imbalances in the concentrations of chosen important/poisonous parts (Pb, Cr, Fe, Zn, As, Cd, Cu, Se, Ni, and Hg) in the serum of newly identified colorectal carcinoma sufferers (n = 165) in comparability with counterpart controls (n = 151) by atomic absorption spectrometry after wet-acid digestion technique.
Serum carcinoembryonic antigen (CEA) of the CRC sufferers was decided utilizing immunoradiometric technique. Body mass index (BMI) which is a longtime threat issue for CRC was additionally calculated for sufferers and wholesome controls. Conversely, common Ni (2.721 μg/g), Cd (0.563 μg/g), As (0.539 μg/g), and Pb (1.273 μg/g) ranges had been considerably elevated in the serum of CRC sufferers in comparison with the wholesome donors, whereas the typical Se (7.052 μg/g), Fe (15.67 μg/g), Cu (2.033 μg/g), and Zn (8.059 μg/g) concentrations had been elevated in controls.
The correlation coefficients between the weather in the cancerous sufferers demonstrated considerably dissimilar communal relationships in contrast with the wholesome topics. Significant variations in the basic ranges had been additionally confirmed for CRC varieties (major colorectal lymphoma, gastrointestinal stromal tumor, and adenocarcinoma) and CRC levels (stage-I, stage-II, stage-III, and stage-IV) among the many sufferers. Majority of the weather demonstrated perceptible disparities in their ranges based mostly on dietary, habitat, gender, and smoking habits of the malignant sufferers and wholesome topics.
 SAA4 antibody |
|
70R-5924 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal SAA4 antibody raised against the middle region of SAA4 |
 SAA4 |
|
E541-021 |
EnoGene |
100ug |
EUR 343 |
 SAA4 Conjugated Antibody |
|
C43534 |
SAB |
100ul |
EUR 397 |
 SAA4 Polyclonal Antibody |
|
ABP56119-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130 |
SAA4 Polyclonal Antibody |
|
ABP56119-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130 |
SAA4 Polyclonal Antibody |
|
ABP56119-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SAA4 from Human. This SAA4 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SAA4 at AA range: 50-130 |
 anti- SAA4 antibody |
|
FNab07574 |
FN Test |
100µg |
EUR 585 |
- Immunogen: serum amyloid A4, constitutive
- Uniprot ID: P35542
- Gene ID: 6291
- Research Area: Cardiovascular
|
|
Description: Antibody raised against SAA4 |
SAA4 Polyclonal Antibody |
|
ES7118-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against SAA4 from Human. This antibody is tested and validated for IHC, WB, ELISA |
SAA4 Polyclonal Antibody |
|
ES7118-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against SAA4 from Human. This antibody is tested and validated for IHC, WB, ELISA |
 Anti-SAA4 antibody |
|
STJ95571 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to SAA4. |
 SAA4 siRNA |
|
20-abx932387 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SAA4 siRNA |
|
20-abx932388 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SAA4 |
|
YF-PA14502 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to SAA4 |
anti-SAA4 |
|
YF-PA14503 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to SAA4 |
anti-SAA4 |
|
YF-PA14504 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to SAA4 |
anti-SAA4 |
|
YF-PA24657 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to SAA4 |
 SAA4 Blocking Peptide |
|
33R-1030 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF20L1 antibody, catalog no. 70R-8973 |
SAA4 Blocking Peptide |
|
33R-8261 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SAA4 antibody, catalog no. 70R-5922 |
SAA4 Blocking Peptide |
|
DF7899-BP |
Affbiotech |
1mg |
EUR 195 |
 Human SAA4 Protein |
|
abx060004-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
 SAA4 cloning plasmid |
|
CSB-CL020659HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 393
- Sequence: atgaggcttttcacaggcattgttttctgctccttggtcatgggagtcaccagtgaaagctggcgttcgtttttcaaggaggctctccaaggggttggggacatgggcagagcctattgggacataatgatatccaatcaccaaaattcaaacagatatctctatgctcggggaaa
- Show more
|
|
Description: A cloning plasmid for the SAA4 gene. |
 SAA4 Rabbit pAb |
|
A16428-100ul |
Abclonal |
100 ul |
EUR 308 |
SAA4 Rabbit pAb |
|
A16428-200ul |
Abclonal |
200 ul |
EUR 459 |
SAA4 Rabbit pAb |
|
A16428-20ul |
Abclonal |
20 ul |
EUR 183 |
SAA4 Rabbit pAb |
|
A16428-50ul |
Abclonal |
50 ul |
EUR 223 |
) Anti-SAA4 (3C11) |
|
YF-MA15335 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SAA4 |
 Monoclonal SAA4 Antibody, Clone: EPR2926 |
|
AMR09806G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A Monoclonal antibody against Human SAA4. The antibodies are raised in Rabbit and are from clone EPR2926. This antibody is applicable in WB and IHC |
) Polyclonal SAA4 Antibody (C-term) |
|
AMR09807G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAA4 (C-term). This antibody is tested and proven to work in the following applications: |
 Anti-SAA4/Serum Amyloid A4 Antibody |
|
A07115 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal SAA4/Serum Amyloid A4 Antibody. Validated in IHC and tested in Human. |
 Antibody) Serum Amyloid A4, Constitutive (SAA4) Antibody |
|
20-abx128626 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Serum Amyloid A4, Constitutive (SAA4) Antibody |
|
20-abx174526 |
Abbexa |
|
|
|
|
Serum Amyloid A4, Constitutive (SAA4) Antibody |
|
20-abx323184 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) SAA4 protein (His tag) |
|
80R-1554 |
Fitzgerald |
50 ug |
EUR 397 |
|
Description: Purified recombinant Human SAA4 protein |
 Mouse SAA4 shRNA Plasmid |
|
20-abx972561 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SAA4 shRNA Plasmid |
|
20-abx954237 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SAA4 Recombinant Protein (Human) |
|
RP027541 |
ABM |
100 ug |
Ask for price |
) SAA4 Recombinant Protein (Rat) |
|
RP227402 |
ABM |
100 ug |
Ask for price |
) SAA4 Recombinant Protein (Mouse) |
|
RP169868 |
ABM |
100 ug |
Ask for price |
 Antibody) Human Serum Amyloid A-4 (SAA4) Antibody |
|
13031-05011 |
AssayPro |
150 ug |
EUR 217 |
 Antibody) Serum Amyloid A-4 Protein (SAA4) Antibody |
|
abx029249-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serum Amyloid A-4 Protein (SAA4) Antibody |
|
abx029249-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serum Amyloid A-4 Protein (SAA4) Antibody |
|
abx237574-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
 Serum amyloid A /SAA4/CSAA |
|
E21-F15 |
EnoGene |
10ug |
EUR 343 |
 (pORF)) Saa4 ORF Vector (Rat) (pORF) |
|
ORF075802 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SAA4 ORF Vector (Human) (pORF) |
|
ORF009181 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Saa4 ORF Vector (Mouse) (pORF) |
|
ORF056624 |
ABM |
1.0 ug DNA |
EUR 506 |
) SAA2-SAA4 Recombinant Protein (Human) |
|
RP095754 |
ABM |
100 ug |
Ask for price |
 (OKCD08499)) SAA4 ELISA Kit (Human) (OKCD08499) |
|
OKCD08499 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: SAA4 is a major acute phase reactant. It is an Apolipoprotein of the HDL complex.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL |
 (OKEH05734)) SAA4 ELISA Kit (Mouse) (OKEH05734) |
|
OKEH05734 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
|
Description: Description of target: Major acute phase reactant. Apolipoprotein of the HDL complex. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
 (OKEH07586)) SAA4 ELISA Kit (Bovine) (OKEH07586) |
|
OKEH07586 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
|
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
 (OKEH02075)) SAA4 ELISA Kit (Human) (OKEH02075) |
|
OKEH02075 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL |
) Saa4 sgRNA CRISPR Lentivector set (Rat) |
|
K7166301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Saa4 sgRNA CRISPR Lentivector set (Mouse) |
|
K3373601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) SAA4 sgRNA CRISPR Lentivector set (Human) |
|
K2084901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (pORF)) SAA2-SAA4 ORF Vector (Human) (pORF) |
|
ORF031919 |
ABM |
1.0 ug DNA |
Ask for price |
) Recombinant Serum Amyloid A4, Constitutive (SAA4) |
|
4-RPD529Hu01 |
Cloud-Clone |
-
EUR 496.03
-
EUR 236.00
-
EUR 1585.12
-
EUR 595.04
-
EUR 1090.08
-
EUR 395.00
-
EUR 3812.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P35542
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 45.2kDa
- Isoelectric Point: 6.9
|
|
Description: Recombinant Human Serum Amyloid A4, Constitutive expressed in: E.coli |
 Antibody (Biotin Conjugate)) Human Serum Amyloid A-4 (SAA4) Antibody (Biotin Conjugate) |
|
13031-05021 |
AssayPro |
150 ug |
EUR 276 |
 Polyclonal Antibody (Human, Mouse)) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse) |
|
4-PAD529Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4) |
 Protein) Human Serum Amyloid A4, Constitutive (SAA4) Protein |
|
20-abx167047 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2138.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) Saa4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7166302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Saa4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7166303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Saa4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7166304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3373602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3373603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Saa4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3373604 |
ABM |
1.0 ug DNA |
EUR 154 |
) SAA2-SAA4 sgRNA CRISPR Lentivector set (Human) |
|
K2800601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) SAA4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2084902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SAA4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2084903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SAA4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2084904 |
ABM |
1.0 ug DNA |
EUR 154 |
 SAA4 Serum Amyloid A4 Human Recombinant Protein |
|
PROTP35542 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: SAA4 Human Recombinant fused with a 21 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 131 amino acids (21-130 a.a.) and having a molecular mass of 14.9kDa. The SAA4 is purified by proprietary chromatographic techniques. |
 (pPB-C-His)) SAA4 Protein Vector (Rat) (pPB-C-His) |
|
PV303206 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SAA4 Protein Vector (Rat) (pPB-N-His) |
|
PV303207 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SAA4 Protein Vector (Rat) (pPM-C-HA) |
|
PV303208 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SAA4 Protein Vector (Rat) (pPM-C-His) |
|
PV303209 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SAA4 Protein Vector (Mouse) (pPB-C-His) |
|
PV226494 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SAA4 Protein Vector (Mouse) (pPB-N-His) |
|
PV226495 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SAA4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV226496 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SAA4 Protein Vector (Mouse) (pPM-C-His) |
|
PV226497 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SAA4 Protein Vector (Human) (pPB-C-His) |
|
PV036721 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SAA4 Protein Vector (Human) (pPB-N-His) |
|
PV036722 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SAA4 Protein Vector (Human) (pPM-C-HA) |
|
PV036723 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SAA4 Protein Vector (Human) (pPM-C-His) |
|
PV036724 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human SAA4 Protein, His, E.coli-10ug |
|
QP13410-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human SAA4 Protein, His, E.coli-1mg |
|
QP13410-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human SAA4 Protein, His, E.coli-2ug |
|
QP13410-2ug |
EnQuireBio |
2ug |
EUR 155 |
 Saa4 3'UTR Luciferase Stable Cell Line |
|
TU118311 |
ABM |
1.0 ml |
Ask for price |
 Saa4 3'UTR GFP Stable Cell Line |
|
TU168311 |
ABM |
1.0 ml |
Ask for price |
Saa4 3'UTR Luciferase Stable Cell Line |
|
TU219889 |
ABM |
1.0 ml |
Ask for price |
Saa4 3'UTR GFP Stable Cell Line |
|
TU269889 |
ABM |
1.0 ml |
Ask for price |
 SAA4 3'UTR GFP Stable Cell Line |
|
TU072548 |
ABM |
1.0 ml |
EUR 1394 |
 SAA4 3'UTR Luciferase Stable Cell Line |
|
TU022548 |
ABM |
1.0 ml |
EUR 1394 |
 AssayLite Antibody (FITC Conjugate)) Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (FITC Conjugate) |
|
13031-05041 |
AssayPro |
150 ug |
EUR 428 |
 AssayLite Antibody (RPE Conjugate)) Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (RPE Conjugate) |
|
13031-05051 |
AssayPro |
150 ug |
EUR 428 |
 AssayLite Antibody (APC Conjugate)) Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (APC Conjugate) |
|
13031-05061 |
AssayPro |
150 ug |
EUR 428 |
 AssayLite Antibody (PerCP Conjugate)) Human Serum Amyloid A-4 (SAA4) AssayLite Antibody (PerCP Conjugate) |
|
13031-05071 |
AssayPro |
150 ug |
EUR 471 |
 Polyclonal Antibody (Human, Mouse), APC) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), APC |
|
4-PAD529Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Mouse), Biotinylated) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), Biotinylated |
|
4-PAD529Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Mouse), Cy3) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), Cy3 |
|
4-PAD529Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Mouse), FITC) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), FITC |
|
4-PAD529Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Mouse), HRP) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), HRP |
|
4-PAD529Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Mouse), PE) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), PE |
|
4-PAD529Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with PE. |
) ELISA kit for Human SAA4 (Serum Amyloid A4) |
|
E-EL-H5638 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's SAA4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SAA4. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human SAA4 (Serum Amyloid A4) in samples from Serum, Plasma, Cell supernatant |
 ELISA Kit) Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit |
|
20-abx153011 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
) Recombinant Human Serum Amyloid A4/SAA4 (C-6His) |
|
CF15-10ug |
Novoprotein |
10ug |
EUR 156 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0. |
Recombinant Human Serum Amyloid A4/SAA4 (C-6His) |
|
CF15-1mg |
Novoprotein |
1mg |
EUR 2283 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0. |
Recombinant Human Serum Amyloid A4/SAA4 (C-6His) |
|
CF15-500ug |
Novoprotein |
500ug |
EUR 1613 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0. |
Recombinant Human Serum Amyloid A4/SAA4 (C-6His) |
|
CF15-50ug |
Novoprotein |
50ug |
EUR 369 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, 200mM NaCl, 0.5mM EDTA, 20% Glycerol, pH 8.0. |
 CLIA Kit) Human Serum Amyloid A4, Constitutive (SAA4) CLIA Kit |
|
20-abx494308 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Protein) Human Serum Amyloid A-4 Protein (SAA4) Protein |
|
20-abx262355 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 (CMV) (pLenti-GIII-CMV)) SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV648229 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) SAA4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV648233 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) SAA4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV648234 |
ABM |
1.0 ug DNA |
EUR 514 |
 (Target 1)) SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2800602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2800603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SAA2-SAA4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2800604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SAA2-SAA4 Protein Vector (Human) (pPB-C-His) |
|
PV127674 |
ABM |
500 ng |
Ask for price |
 (pPB-N-His)) SAA2-SAA4 Protein Vector (Human) (pPB-N-His) |
|
PV127675 |
ABM |
500 ng |
Ask for price |
 (pPM-C-HA)) SAA2-SAA4 Protein Vector (Human) (pPM-C-HA) |
|
PV127676 |
ABM |
500 ng |
Ask for price |
 (pPM-C-His)) SAA2-SAA4 Protein Vector (Human) (pPM-C-His) |
|
PV127677 |
ABM |
500 ng |
Ask for price |
Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit |
|
SED529Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids. |
Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit |
|
SED529Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids. |
Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit |
|
SED529Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids. |
Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit |
|
SED529Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Serum Amyloid A4, Constitutive (SAA4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human serum Amyloid A4, Constitutive (SAA4) in serum, plasma and other biological fluids. |
Human Serum Amyloid A4, Constitutive (SAA4) ELISA Kit |
|
4-SED529Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Serum Amyloid A4, Constitutive elisa. Alternative names of the recognized antigen: C-SAA
- CSAA
- SA-A4
- Constitutively expressed serum amyloid A protein
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Serum Amyloid A4, Constitutive (SAA4) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Polyclonal Antibody (Human, Mouse), APC-Cy7) Serum Amyloid A4, Constitutive (SAA4) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
|
4-PAD529Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SAA4 (Glu19~Tyr130)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Serum Amyloid A4, Constitutive (SAA4). This antibody is labeled with APC-Cy7. |
 ELISA kit) Human Serum amyloid A-4 protein(SAA4) ELISA kit |
|
CSB-EL020659HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Serum amyloid A-4 protein (SAA4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Serum amyloid A-4 protein(SAA4) ELISA kit |
|
1-CSB-EL020659HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Serum amyloid A-4 protein(SAA4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA Kit) Human Serum amyloid A-4 protein (SAA4) ELISA Kit |
|
abx250406-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 Mouse Saa4/ Serum amyloid A-4 protein ELISA Kit |
|
E1304Mo |
Sunlong |
1 Kit |
EUR 632 |
 Human SAA4/ Serum amyloid A-4 protein ELISA Kit |
|
E2208Hu |
Sunlong |
1 Kit |
EUR 605 |
 ELISA Kit) Human SAA4(Serum amyloid A-4 protein) ELISA Kit |
|
EH1155 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.312-20 ng/ml
- Uniprot ID: P35542
- Alias: SAA4(Serum amyloid A-4 protein)/CSAA/C-SAA/Constitutively expressed serum amyloid A protein/SAA5/serum amyloid A4, constitutive
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
 Bovine Serum amyloid A- 4 protein, SAA4 ELISA KIT |
|
ELI-20131b |
Lifescience Market |
96 Tests |
EUR 928 |
 Human Serum amyloid A- 4 protein, SAA4 ELISA KIT |
|
ELI-21759h |
Lifescience Market |
96 Tests |
EUR 824 |
) ELISA kit for Human SAA4 (Serum Amyloid A4, Constitutive) |
|
ELK4953 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Serum Amyloid A4, Constitutive (SAA4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
|
Description: A sandwich ELISA kit for detection of Serum Amyloid A4, Constitutive from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 ELISA Kit) Cow Serum amyloid A-4 protein (SAA4) ELISA Kit |
|
abx514753-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Serum amyloid A-4 protein (SAA4) ELISA Kit |
|
abx514754-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Serum amyloid A-4 protein (SAA4) ELISA Kit |
|
abx514755-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
 Mouse Serum amyloid A- 4 protein, Saa4 ELISA KIT |
|
ELI-40813m |
Lifescience Market |
96 Tests |
EUR 865 |
 (CMV) (pLenti-GIII-CMV)) SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV785495 |
ABM |
1.0 ug DNA |
Ask for price |
 (UbC) (pLenti-GIII-UbC)) SAA2-SAA4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV785499 |
ABM |
1.0 ug DNA |
Ask for price |
 (EF1a) (pLenti-GIII-EF1a)) SAA2-SAA4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV785500 |
ABM |
1.0 ug DNA |
Ask for price |
) ELISA kit for Human Serum amyloid A-4 protein (SAA4) |
|
KTE60753-48T |
Abbkine |
48T |
EUR 332 |
- Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serum amyloid A-4 protein (SAA4) |
|
KTE60753-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Serum amyloid A-4 protein (SAA4) |
|
KTE60753-96T |
Abbkine |
96T |
EUR 539 |
- Studying the protein and the cDNA, Whitehead et al. (1992) identified a new member of the serum amyloid A protein superfamily, designated SAA4, as constitutive apolipoprotein of high density lipoprotein. Watson et al. (1992) analyzed the structure of
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Serum amyloid A-4 protein (SAA4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
|
K7166305 |
ABM |
3 x 1.0 ug |
EUR 376 |
) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
|
K3373605 |
ABM |
3 x 1.0 ug |
EUR 376 |
) SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K2084905 |
ABM |
3 x 1.0 ug |
EUR 376 |
 Saa4 ELISA Kit| Mouse Serum amyloid A-4 protein ELISA Kit |
|
EF016185 |
Lifescience Market |
96 Tests |
EUR 689 |
 SAA4 ELISA Kit| Bovine Serum amyloid A-4 protein ELISA Kit |
|
EF011896 |
Lifescience Market |
96 Tests |
EUR 689 |
 (CMV) (pLenti-GIII-CMV-C-term-HA)) SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
|
LV648230 |
ABM |
1.0 ug DNA |
EUR 514 |
 (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)) SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
|
LV648231 |
ABM |
1.0 ug DNA |
EUR 572 |
 (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)) SAA4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
|
LV648232 |
ABM |
1.0 ug DNA |
EUR 572 |
 (Target 1)) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
|
K7166306 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
|
K7166307 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
|
K7166308 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 1)) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
|
K3373606 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
|
K3373607 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) Saa4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
|
K3373608 |
ABM |
1.0 ug DNA |
EUR 167 |
) SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K2800605 |
ABM |
3 x 1.0 ug |
EUR 376 |
 (Target 1)) SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
|
K2084906 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
|
K2084907 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
|
K2084908 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 1)) SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
|
K2800606 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 2)) SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
|
K2800607 |
ABM |
1.0 ug DNA |
EUR 167 |
 (Target 3)) SAA2-SAA4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
|
K2800608 |
ABM |
1.0 ug DNA |
EUR 167 |
 (CMV) (pLenti-GIII-CMV-C-term-HA)) SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
|
LV785496 |
ABM |
1.0 ug DNA |
Ask for price |
 (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)) SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
|
LV785497 |
ABM |
1.0 ug DNA |
Ask for price |
 (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)) SAA2-SAA4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
|
LV785498 |
ABM |
1.0 ug DNA |
Ask for price |
 H2B Antibody Antibody |
|
AF4659 |
Affbiotech |
200ul |
EUR 376 |
|
Description: H2B Antibody Antibody detects endogenous levels of H2B. |
 anti- Antibody^Polyclonal antibody control antibody |
|
LSMab09882 |
Lifescience Market |
100 ug |
EUR 438 |
 Antibody) Ly1 Antibody Reactive (LYAR) Antibody |
|
20-abx008109 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
 Antibody) Anti-Glycolipid Antibody (AGA) Antibody |
|
20-abx004855 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
|
20-abx123734 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Glycolipid Antibody (AGA) Antibody |
|
abx036399-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
|
20-abx014333 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
|
abx033330-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
|
abx033330-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Antibody) Anti-Glycoprotein Antibody (GP) Antibody |
|
20-abx319900 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
|
20-abx319901 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
|
20-abx319905 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Glycoprotein Antibody (GP) Antibody |
|
20-abx319913 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ly1 Antibody Reactive (LYAR) Antibody |
|
abx234901-100ug |
Abbexa |
100 ug |
EUR 551 |
|
|
)
)
)
 ELISA Kit)
)
)
)
)
)
)
)
)
)
)
)
)
)
)
)
 - for Serum or Plasma)
 Protein Assay Plus Reagents)
 protein (>99%, Protease-free))
)
, Xeno-Free)
)
)
, Xeno-Free Heat Inactivated)
)
ELISA Kit)
)
 Reference serum)
)
)
)
 Protein)
 protein (>99%, Protease & IgG-free; Low endotoxin; Diagnostic grade))
)
 Serum ELISA Kit)
 for western (makes ~2-L buffer @5% BSA))
 for western (makes ~10-L buffer @5% BSA))
