USP47 antibody
70R-12971 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal USP47 antibody
USP47 Antibody
43345-100ul 100ul
EUR 252
USP47 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
USP47 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
USP47 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
USP47 antibody
70R-9744 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP47 antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA26299 50 ul
EUR 334
Description: Mouse polyclonal to USP47
PVT17428 2 ug
EUR 231
USP47 Rabbit pAb
A15461-100ul 100 ul
EUR 308
USP47 Rabbit pAb
A15461-200ul 200 ul
EUR 459
USP47 Rabbit pAb
A15461-20ul 20 ul
EUR 183
USP47 Rabbit pAb
A15461-50ul 50 ul
EUR 223
USP47 Blocking Peptide
33R-8539 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP47 antibody, catalog no. 70R-9744
USP7/USP47 Inhibitor
EUR 142
USP7/USP47 Inhibitor
EUR 414
USP47 Conjugated Antibody
C43345 100ul
EUR 397
USP47 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP47 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP47 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP47 cloning plasmid
CSB-CL856964HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 474
  • Sequence: atgaagtccatgtcacagcttgcagttttgtcaagacggtggaagccttcagagatgaagttggatcccttccaggaggttgtattggaaagcagtagtgtggacgaattgcgagagaagcttagtgaaatcagtgggattcctttggatgatattgaatttgctaagggtagagg
  • Show more
Description: A cloning plasmid for the USP47 gene.
USP47 Polyclonal Antibody
A61698 100 µg
EUR 570.55
Description: reagents widely cited
USP7/USP47 inhibitor
HY-13487 5mg
EUR 533
Anti-USP47 (5F9)
YF-MA11552 100 ug
EUR 363
Description: Mouse monoclonal to USP47
Anti-USP47 (1E6)
YF-MA18721 100 ug
EUR 363
Description: Mouse monoclonal to USP47
Anti-USP47 antibody
STJ117656 100 µl
EUR 277
pENTR223-USP47 vector
PVT11753 2 ug
EUR 304
USP47 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP47 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP47 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal USP47 Antibody (Center)
APR04849G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP47 (Center). This antibody is tested and proven to work in the following applications:
ELI-17760c 96 Tests
EUR 928
Mouse USP47 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP47 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP7/USP47 Inhibitor, P 22077
EUR 370
USP7/USP47 Inhibitor, P 22077
EUR 131
USP47 Polyclonal Antibody, Biotin Conjugated
A61699 100 µg
EUR 570.55
Description: Ask the seller for details
USP47 Polyclonal Antibody, FITC Conjugated
A61700 100 µg
EUR 570.55
Description: The best epigenetics products
USP47 Polyclonal Antibody, HRP Conjugated
A61701 100 µg
EUR 570.55
Description: kits suitable for this type of research
Usp47 ORF Vector (Mouse) (pORF)
ORF061157 1.0 ug DNA
EUR 1572
Usp47 ORF Vector (Mouse) (pORF)
ORF061158 1.0 ug DNA
EUR 1572
Usp47 ORF Vector (Rat) (pORF)
ORF078711 1.0 ug DNA
EUR 2080
USP47 ORF Vector (Human) (pORF)
ORF011381 1.0 ug DNA
EUR 95
pECMV-Usp47-m-FLAG Plasmid
PVT15517 2 ug
EUR 325
Ubiquitin Specific Peptidase 47 (USP47) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 47 (USP47) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 47 (USP47) Antibody
abx122396-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 47 (USP47) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Usp47 sgRNA CRISPR Lentivector set (Rat)
K6528301 3 x 1.0 ug
EUR 339
USP47 sgRNA CRISPR Lentivector set (Human)
K2601601 3 x 1.0 ug
EUR 339
Usp47 sgRNA CRISPR Lentivector set (Mouse)
K4096501 3 x 1.0 ug
EUR 339
Monoclonal USP47 Antibody (monoclonal) (M01), Clone: 5F9
AMM04301G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human USP47 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F9. This antibody is applicable in WB and IF, E
Usp47 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6528302 1.0 ug DNA
EUR 154
Usp47 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6528303 1.0 ug DNA
EUR 154
Usp47 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6528304 1.0 ug DNA
EUR 154
USP47 sgRNA CRISPR Lentivector (Human) (Target 1)
K2601602 1.0 ug DNA
EUR 154
USP47 sgRNA CRISPR Lentivector (Human) (Target 2)
K2601603 1.0 ug DNA
EUR 154
USP47 sgRNA CRISPR Lentivector (Human) (Target 3)
K2601604 1.0 ug DNA
EUR 154
Usp47 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4096502 1.0 ug DNA
EUR 154
Usp47 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4096503 1.0 ug DNA
EUR 154
Usp47 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4096504 1.0 ug DNA
EUR 154
Usp47 3'UTR Luciferase Stable Cell Line
TU121681 1.0 ml Ask for price
USP47 3'UTR GFP Stable Cell Line
TU078013 1.0 ml
EUR 2333
Usp47 3'UTR GFP Stable Cell Line
TU171681 1.0 ml Ask for price
Usp47 3'UTR Luciferase Stable Cell Line
TU222952 1.0 ml Ask for price
USP47 3'UTR Luciferase Stable Cell Line
TU028013 1.0 ml
EUR 2333
Usp47 3'UTR GFP Stable Cell Line
TU272952 1.0 ml Ask for price
USP47 Protein Vector (Mouse) (pPB-C-His)
PV244626 500 ng
EUR 2319
USP47 Protein Vector (Mouse) (pPB-N-His)
PV244627 500 ng
EUR 2319
USP47 Protein Vector (Mouse) (pPM-C-HA)
PV244628 500 ng
EUR 2319
USP47 Protein Vector (Mouse) (pPM-C-His)
PV244629 500 ng
EUR 2319
USP47 Protein Vector (Mouse) (pPB-C-His)
PV244630 500 ng
EUR 2349
USP47 Protein Vector (Mouse) (pPB-N-His)
PV244631 500 ng
EUR 2349
USP47 Protein Vector (Mouse) (pPM-C-HA)
PV244632 500 ng
EUR 2349