USP26

USP26 Antibody
46292-50ul	SAB	50ul	EUR 187

USP26 Antibody
1-CSB-PA874835ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP26. Recognizes USP26 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

USP26 Antibody
1-CSB-PA874835ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against USP26. Recognizes USP26 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

USP26 Antibody
DF9986	Affbiotech	200ul	EUR 304
Description: USP26 Antibody detects endogenous levels of total USP26.

USP26 antibody
70R-9740	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal USP26 antibody

USP26 siRNA
20-abx939200	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP26 siRNA
20-abx939201	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP26 Antibody
ABD9986	Lifescience Market	100 ug	EUR 438

USP26 Blocking Peptide
33R-1999	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP26 antibody, catalog no. 70R-9740

USP26 Blocking Peptide
DF9986-BP	Affbiotech	1mg	EUR 195

USP26 Conjugated Antibody
C46292	SAB	100ul	EUR 397

USP26 cloning plasmid
CSB-CL874835HU-10ug	Cusabio	10ug	EUR 877
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2742 Sequence: ATGGCTGCCCTATTCCTACGTGGTTTTGTCCAAATAGGGAACTGCAAGACTGGGATATCTAAGTCAAAAGAAGCATTCATTGAAGCAGTGGAAAGAAAGAAGAAAGATAGACTGGTGCTGTATTTCAAAAGTGGAAAATATAGCACTTTTCGGCTAAGTGATAATATTCAAAATG Show more
Description: A cloning plasmid for the USP26 gene.

USP26 Rabbit pAb
A7999-100ul	Abclonal	100 ul	EUR 308

USP26 Rabbit pAb
A7999-200ul	Abclonal	200 ul	EUR 459

USP26 Rabbit pAb
A7999-20ul	Abclonal	20 ul	EUR 183

USP26 Rabbit pAb
A7999-50ul	Abclonal	50 ul	EUR 223

Anti-USP26 (4G8)
YF-MA19482	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to USP26

Anti-USP26 antibody
STJ110306	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases and is a deubiquitinating enzyme (DUB) with His and Cys domains. It is specifically expressed in testis tissue. Mutations in this gene have been associated with Sertoli cell-only syndrome and male infertility.

Mouse USP26 shRNA Plasmid
20-abx979142	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human USP26 shRNA Plasmid
20-abx963197	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Usp26 ORF Vector (Mouse) (pORF)
ORF061131	ABM	1.0 ug DNA	EUR 506

Usp26 ORF Vector (Rat) (pORF)
ORF078692	ABM	1.0 ug DNA	EUR 506

USP26 ORF Vector (Human) (pORF)
ORF014902	ABM	1.0 ug DNA	EUR 354

pECMV-Usp26-m-FLAG Plasmid
PVT15459	Lifescience Market	2 ug	EUR 325

Rabbit Anti-Human USP26 polyclonal antibody
CABT-BL087	Creative Diagnostics	100 ul	EUR 585

Usp26 sgRNA CRISPR Lentivector set (Rat)
K6544501	ABM	3 x 1.0 ug	EUR 339

USP26 sgRNA CRISPR Lentivector set (Human)
K2599501	ABM	3 x 1.0 ug	EUR 339

Usp26 sgRNA CRISPR Lentivector set (Mouse)
K4054701	ABM	3 x 1.0 ug	EUR 339

Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx007162	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx219276	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx142303	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx320982	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin Carboxyl-Terminal Hydrolase 26 (USP26) Antibody
20-abx322474	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Usp26 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6544502	ABM	1.0 ug DNA	EUR 154

Usp26 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6544503	ABM	1.0 ug DNA	EUR 154

Usp26 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6544504	ABM	1.0 ug DNA	EUR 154

USP26 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599502	ABM	1.0 ug DNA	EUR 154

USP26 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599503	ABM	1.0 ug DNA	EUR 154

USP26 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599504	ABM	1.0 ug DNA	EUR 154

Usp26 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4054702	ABM	1.0 ug DNA	EUR 154

Usp26 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4054703	ABM	1.0 ug DNA	EUR 154

Usp26 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4054704	ABM	1.0 ug DNA	EUR 154

Usp26 3'UTR Luciferase Stable Cell Line
TU121659	ABM	1.0 ml	Ask for price

USP26 3'UTR GFP Stable Cell Line
TU077992	ABM	1.0 ml	EUR 1394

Usp26 3'UTR GFP Stable Cell Line
TU171659	ABM	1.0 ml	Ask for price

Usp26 3'UTR Luciferase Stable Cell Line
TU222933	ABM	1.0 ml	Ask for price

USP26 3'UTR Luciferase Stable Cell Line
TU027992	ABM	1.0 ml	EUR 1394

Usp26 3'UTR GFP Stable Cell Line
TU272933	ABM	1.0 ml	Ask for price

USP26 Protein Vector (Mouse) (pPB-C-His)
PV244522	ABM	500 ng	EUR 1065

USP26 Protein Vector (Mouse) (pPB-N-His)
PV244523	ABM	500 ng	EUR 1065

USP26 Protein Vector (Mouse) (pPM-C-HA)
PV244524	ABM	500 ng	EUR 1065

USP26 Protein Vector (Mouse) (pPM-C-His)
PV244525	ABM	500 ng	EUR 1065

USP26 Protein Vector (Rat) (pPB-C-His)
PV314766	ABM	500 ng	EUR 1191

USP26 Protein Vector (Rat) (pPB-N-His)
PV314767	ABM	500 ng	EUR 1191

USP26 Protein Vector (Rat) (pPM-C-HA)
PV314768	ABM	500 ng	EUR 1191

USP26 Protein Vector (Rat) (pPM-C-His)
PV314769	ABM	500 ng	EUR 1191

USP26 Protein Vector (Human) (pPB-C-His)
PV059605	ABM	500 ng	EUR 481

USP26 Protein Vector (Human) (pPB-N-His)
PV059606	ABM	500 ng	EUR 481

USP26 Protein Vector (Human) (pPM-C-HA)
PV059607	ABM	500 ng	EUR 481

USP26 Protein Vector (Human) (pPM-C-His)
PV059608	ABM	500 ng	EUR 481

Human Ubiquitin carboxyl- terminal hydrolase 26, USP26 ELISA KIT
ELI-17869h	Lifescience Market	96 Tests	EUR 824

Mouse Ubiquitin carboxyl- terminal hydrolase 26, Usp26 ELISA KIT
ELI-39980m	Lifescience Market	96 Tests	EUR 865

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6544505	ABM	3 x 1.0 ug	EUR 376

USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2599505	ABM	3 x 1.0 ug	EUR 376

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4054705	ABM	3 x 1.0 ug	EUR 376

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6544506	ABM	1.0 ug DNA	EUR 167

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6544507	ABM	1.0 ug DNA	EUR 167

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6544508	ABM	1.0 ug DNA	EUR 167

USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2599506	ABM	1.0 ug DNA	EUR 167

USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2599507	ABM	1.0 ug DNA	EUR 167

USP26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2599508	ABM	1.0 ug DNA	EUR 167

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4054706	ABM	1.0 ug DNA	EUR 167

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4054707	ABM	1.0 ug DNA	EUR 167

Usp26 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4054708	ABM	1.0 ug DNA	EUR 167