SULT1A3 Antibody
45165-100ul 100ul
EUR 252
SULT1A3 Antibody
45165-50ul 50ul
EUR 187
SULT1A3 Antibody
DF7889 200ul
EUR 304
Description: SULT1A3 Antibody detects endogenous levels of total SULT1A3.
SULT1A3 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
SULT1A3 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
SULT1A3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SULT1A3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:50-1:200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SULT1A3 Antibody
ABD7889 100 ug
EUR 438
SULT1A3 Antibody
ABD8006 100 ug
EUR 438
SULT1A3 Rabbit pAb
A12357-100ul 100 ul
EUR 308
SULT1A3 Rabbit pAb
A12357-200ul 200 ul
EUR 459
SULT1A3 Rabbit pAb
A12357-20ul 20 ul
EUR 183
SULT1A3 Rabbit pAb
A12357-50ul 50 ul
EUR 223
SULT1A3 Blocking Peptide
DF7889-BP 1mg
EUR 195
SULT1A3 / SULT1A4 Antibody
abx027053-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SULT1A3 / SULT1A4 Antibody
abx027053-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SULT1A3 Conjugated Antibody
C45165 100ul
EUR 397
SULT1A3 cloning plasmid
CSB-CL022935HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggagctgatccaggacacctcccgcccgccactggagtacgtgaagggggtcccgctcatcaagtactttgcagaggcactggggcccctgcagagcttccaagcccgacctgatgacctgctcatcaacacctaccccaagtctggcaccacctgggtgagccagatactgga
  • Show more
Description: A cloning plasmid for the SULT1A3 gene.
SULT1A3 Rabbit pAb
A7932-100ul 100 ul
EUR 308
SULT1A3 Rabbit pAb
A7932-200ul 200 ul
EUR 459
SULT1A3 Rabbit pAb
A7932-20ul 20 ul
EUR 183
SULT1A3 Rabbit pAb
A7932-50ul 50 ul
EUR 223
SULT1A3 Polyclonal Antibody
A56695 100 µg
EUR 570.55
Description: Ask the seller for details
anti- SULT1A3 antibody
FNab08378 100µg
EUR 548.75
  • Immunogen: sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3
  • Uniprot ID: P0DMM9
  • Gene ID: 6818
  • Research Area: Metabolism
Description: Antibody raised against SULT1A3
Anti-SULT1A3 antibody
PAab08378 100 ug
EUR 386
Anti-SULT1A3 antibody
STJ110241 100 µl
EUR 277
Description: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains.
Anti-SULT1A3 antibody
STJ114235 100 µl
EUR 277
Description: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains.
EF003350 96 Tests
EUR 689
Polyclonal SULT1A3 Antibody (Center)
APR13597G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1A3 (Center). This antibody is tested and proven to work in the following applications:
SULT1A3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SULT1A3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SULT1A3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SULT1A3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SULT1A3 Recombinant Protein (Human)
RP100602 100 ug Ask for price
Human Sulfotransferase 1A3/1A4 (SULT1A3)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Sulfotransferase 1A3/1A4(SULT1A3) expressed in E.coli
SULT1A3 Polyclonal Antibody, HRP Conjugated
A56696 100 µg
EUR 570.55
Description: The best epigenetics products
SULT1A3 Polyclonal Antibody, FITC Conjugated
A56697 100 µg
EUR 570.55
Description: kits suitable for this type of research
SULT1A3 Polyclonal Antibody, Biotin Conjugated
A56698 100 µg
EUR 570.55
Description: fast delivery possible
SULT1A3 ORF Vector (Human) (pORF)
ORF033535 1.0 ug DNA
EUR 405
SULT1A3 ELISA Kit (Human) (OKCA01534)
OKCA01534 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.8 pg/mL
Polyclonal SULT1A3/SULT1A4 Antibody (N-term)
APR13598G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1A3/SULT1A4 (N-term). This antibody is tested and proven to work in the following applications:
SULT1A3 sgRNA CRISPR Lentivector set (Human)
K2312401 3 x 1.0 ug
EUR 339
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx028284-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx028284-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx145876-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx238378-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Human Sulfotransferase 1A3/1A4, SULT1A3 ELISA KIT
ELI-18684h 96 Tests
EUR 824
Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.
Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-1mg 1mg
EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.
Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-500ug 500ug
EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.
Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SULT1A3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2312402 1.0 ug DNA
EUR 154
SULT1A3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2312403 1.0 ug DNA
EUR 154
SULT1A3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2312404 1.0 ug DNA
EUR 154
SULT1A3 3'UTR Luciferase Stable Cell Line
TU024911 1.0 ml
EUR 1394
SULT1A3 3'UTR GFP Stable Cell Line
TU074911 1.0 ml
EUR 1394
SULT1A3 Protein Vector (Human) (pPB-C-His)
PV134138 500 ng
EUR 552
SULT1A3 Protein Vector (Human) (pPB-N-His)
PV134139 500 ng
EUR 552
SULT1A3 Protein Vector (Human) (pPM-C-HA)
PV134140 500 ng
EUR 552
SULT1A3 Protein Vector (Human) (pPM-C-His)
PV134141 500 ng
EUR 552
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-100ug
QP6748-ec-100ug 100ug
EUR 408
Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-10ug
QP6748-ec-10ug 10ug
EUR 200
Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-1mg
QP6748-ec-1mg 1mg
EUR 1632
Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-200ug
QP6748-ec-200ug 200ug
EUR 634