SMC1A antibody
23082-100ul 100ul
EUR 390
SMC1A antibody
70R-13301 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SMC1A antibody
SMC1A antibody
10R-2958 3 ml
EUR 282
Description: Rat monoclonal SMC1A antibody
SMC1A Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SMC1A. Recognizes SMC1A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
SMC1A Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SMC1A. Recognizes SMC1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SMC1A antibody
70R-8278 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SMC1A antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SMC1A Polyclonal Antibody
30411-100ul 100ul
EUR 252
SMC1A Polyclonal Antibody
30411-50ul 50ul
EUR 187
SMC1A Polyclonal Antibody
30791-100ul 100ul
EUR 252
SMC1A Polyclonal Antibody
30791-50ul 50ul
EUR 187
SMC1A Blocking Peptide
33R-9611 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SMC1A antibody, catalog no. 70R-8278
SMC1A cloning plasmid
CSB-CL614804HU-10ug 10ug
EUR 1305
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3702
  • Sequence: atggggttcctgaaactgattgagattgagaactttaagtcgtacaagggtcgacagattatcggaccatttcagaggttcaccgccatcattggacccaatggctctggtaagtcaaatctcatggatgccatcagctttgtgctaggtgaaaaaaccagcaacctgcgggtaa
  • Show more
Description: A cloning plasmid for the SMC1A gene.
SMC1A Rabbit pAb
A7008-100ul 100 ul
EUR 308
SMC1A Rabbit pAb
A7008-200ul 200 ul
EUR 459
SMC1A Rabbit pAb
A7008-20ul 20 ul
EUR 183
SMC1A Rabbit pAb
A7008-50ul 50 ul
EUR 223
SMC1A Rabbit pAb
A2240-100ul 100 ul
EUR 308
SMC1A Rabbit pAb
A2240-200ul 200 ul
EUR 459
SMC1A Rabbit pAb
A2240-20ul 20 ul
EUR 183
SMC1A Rabbit pAb
A2240-50ul 50 ul
EUR 223
SMC1A (pS957) Antibody
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SMC1A (pS957) Antibody
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
anti- SMC1A antibody
FNab08016 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:20 - 1:100
  • IP : 1:50 - 1:100
  • Immunogen: structural maintenance of chromosomes 1A
  • Uniprot ID: Q14683
  • Gene ID: 8243
  • Research Area: Cell Division and Proliferation, Metabolism, Developm
  • Show more
Description: Antibody raised against SMC1A
Anti-SMC1A antibody
PAab08016 100 ug
EUR 386
Anti-SMC1A antibody
STJ99053 200 µl
EUR 197
Description: Mouse monoclonal to SMC1A.
Anti-SMC1A antibody
STJ99054 200 µl
EUR 197
Description: Mouse monoclonal to SMC1A.
Anti-SMC1A antibody
STJ116171 100 µl
EUR 277
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-SMC1A antibody
STJ29088 100 µl
EUR 277
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.
Phospho-SMC1A (S957) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SMC1A (S957). Recognizes Phospho-SMC1A (S957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
Phospho-SMC1A (S966) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-SMC1A (S966). Recognizes Phospho-SMC1A (S966) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
SMC1A (Ab-957) Antibody
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SMC1A (Ab-957). Recognizes SMC1A (Ab-957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200
SMC1A (Ab-957) Antibody
CSB-PA775738-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against SMC1A (Ab-957). Recognizes SMC1A (Ab-957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:200
Phospho-SMC1A (Ser957) Antibody
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-SMC1A (Ser957). Recognizes Phospho-SMC1A (Ser957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100
Phospho-SMC1A (Ser957) Antibody
CSB-PA581416-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-SMC1A (Ser957). Recognizes Phospho-SMC1A (Ser957) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100
Mouse Smc1a ELISA KIT
ELI-19141m 96 Tests
EUR 865
ELI-29846h 96 Tests
EUR 824
EF003058 96 Tests
EUR 689
Mouse SMC1A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SMC1A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SMC1A Polyclonal Conjugated Antibody
C30411 100ul
EUR 397
SMC1A Polyclonal Conjugated Antibody
C30791 100ul
EUR 397
Human SMC1A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-39429b 96 Tests
EUR 928
PVT14390 2 ug
EUR 703
SMC1A(N-term) Monoclonal Antibody
27022-100ul 100ul
EUR 252
SMC1A(N-term) Monoclonal Antibody
27022-50ul 50ul
EUR 187
SMC1A(C-term) Monoclonal Antibody
27023-100ul 100ul
EUR 252
SMC1A(C-term) Monoclonal Antibody
27023-50ul 50ul
EUR 187
Polyclonal SMC1A Antibody (N-term)
APR03833G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SMC1A (N-term). This antibody is tested and proven to work in the following applications:
Phospho-SMC1A-S957 Rabbit pAb
AP0090-100ul 100 ul
EUR 384
Phospho-SMC1A-S957 Rabbit pAb
AP0090-200ul 200 ul
EUR 554
Phospho-SMC1A-S957 Rabbit pAb
AP0090-20ul 20 ul
EUR 183
Phospho-SMC1A-S957 Rabbit pAb
AP0090-50ul 50 ul
EUR 265
Phospho-SMC1A-S957 Rabbit pAb
AP0204-100ul 100 ul
EUR 384
Phospho-SMC1A-S957 Rabbit pAb
AP0204-200ul 200 ul
EUR 554
Phospho-SMC1A-S957 Rabbit pAb
AP0204-20ul 20 ul Ask for price
Phospho-SMC1A-S957 Rabbit pAb
AP0204-50ul 50 ul
EUR 265
Monoclonal SMC1A (N-terminus) Antibody
AMM03130G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SMC1A (N-terminus). The antibodies are raised in Mouse. This antibody is applicable in WB and IHC, FC
Monoclonal SMC1A(C-term) Antibody
AMM03131G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SMC1A(C-term). The antibodies are raised in Mouse. This antibody is applicable in WB, ICC
Smc1a ORF Vector (Rat) (pORF)
ORF076689 1.0 ug DNA
EUR 506
SMC1A ORF Vector (Human) (pORF)
ORF032593 1.0 ug DNA
EUR 405
Smc1a ORF Vector (Mouse) (pORF)
ORF057962 1.0 ug DNA
EUR 506
Anti-Phospho-SMC1A-(S957) antibody
STJ22400 100 µl
EUR 393
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-Phospho-SMC1A-(S957) antibody
STJ22401 100 µl
EUR 393
Description: Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms.
SMC1A(N-term) Conjugated Monoclonal Antibody
C27022 100ul
EUR 397
Smc1a sgRNA CRISPR Lentivector set (Rat)
K7081601 3 x 1.0 ug
EUR 339
SMC1A sgRNA CRISPR Lentivector set (Human)
K2199801 3 x 1.0 ug
EUR 339
Smc1a sgRNA CRISPR Lentivector set (Mouse)
K3941501 3 x 1.0 ug
EUR 339
Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
abx027456-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
abx027456-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
abx159694-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
abx159695-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
abx238016-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Structural Maintenance of Chromosomes 1A (SMC1A) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
abx331418-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Structural Maintenance Of Chromosomes 1A (SMC1A) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Smc1a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7081602 1.0 ug DNA
EUR 154
Smc1a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7081603 1.0 ug DNA
EUR 154
Smc1a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7081604 1.0 ug DNA
EUR 154
SMC1A sgRNA CRISPR Lentivector (Human) (Target 1)
K2199802 1.0 ug DNA
EUR 154
SMC1A sgRNA CRISPR Lentivector (Human) (Target 2)
K2199803 1.0 ug DNA
EUR 154