SIAH1

SIAH1 antibody
70R-31987	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal SIAH1 antibody

SIAH1 Antibody
ABD3341	Lifescience Market	100 ug	EUR 438

SIAH1 Antibody
ABD6963	Lifescience Market	100 ug	EUR 438

SIAH1 Antibody
43329-100ul	SAB	100ul	EUR 252

SIAH1 Antibody
32672-100ul	SAB	100ul	EUR 252

SIAH1 antibody
20R-1085	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SIAH1 antibody

SIAH1 antibody
20R-1194	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SIAH1 antibody

SIAH1 antibody
70R-20265	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SIAH1 antibody

SIAH1 Antibody
DF6963	Affbiotech	200ul	EUR 304
Description: SIAH1 Antibody detects endogenous levels of total SIAH1.

SIAH1 siRNA
20-abx933339	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SIAH1 siRNA
20-abx933340	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SIAH1 Antibody
1-CSB-PA818230ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SIAH1. Recognizes SIAH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SIAH1 Antibody
1-CSB-PA490759	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SIAH1. Recognizes SIAH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SIAH1 Antibody
1-CSB-PA021287GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SIAH1. Recognizes SIAH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-SIAH1
YF-PA24700	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SIAH1

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
20-abx001938	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
20-abx141683	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx146887-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx028787-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx028787-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
20-abx320134	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx431586-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx237857-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

E3 ubiquitin-protein ligase SIAH1 (SIAH1) Antibody
20-abx241843	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human E3 ubiquitin-protein ligase SIAH1 (SIAH1)
1-CSB-EP818230HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 61.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase SIAH1(SIAH1) expressed in E.coli

E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody (Biotin)
abx431587-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

SIAH1 Conjugated Antibody
C43329	SAB	100ul	EUR 397

SIAH1 Conjugated Antibody
C32672	SAB	100ul	EUR 397

anti- SIAH1 antibody
FNab07857	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: seven in absentia homolog 1 (Drosophila) Uniprot ID: Q8IUQ4 Gene ID: 6477 Research Area: Neuroscience, Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against SIAH1

SIAH1 / 2 Antibody
20-abx134564	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

SIAH1 / SIAH2 Antibody
20-abx329283	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

SIAH1/2 antibody
70R-51810	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal SIAH1/2 antibody

SIAH1 Rabbit pAb
A12490-100ul	Abclonal	100 ul	EUR 308

SIAH1 Rabbit pAb
A12490-200ul	Abclonal	200 ul	EUR 459

SIAH1 Rabbit pAb
A12490-20ul	Abclonal	20 ul	EUR 183

SIAH1 Rabbit pAb
A12490-50ul	Abclonal	50 ul	EUR 223

SIAH1 Rabbit pAb
A2494-100ul	Abclonal	100 ul	EUR 308

SIAH1 Rabbit pAb
A2494-200ul	Abclonal	200 ul	EUR 459

SIAH1 Rabbit pAb
A2494-20ul	Abclonal	20 ul	EUR 183

SIAH1 Rabbit pAb
A2494-50ul	Abclonal	50 ul	EUR 223

SIAH1 Blocking Peptide
33R-5522	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SIAH1 antibody, catalog no. 20R-1194

SIAH1 Blocking Peptide
33R-3086	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SIAH1 antibody, catalog no. 20R-1085

SIAH1 Blocking Peptide
DF6963-BP	Affbiotech	1mg	EUR 195

SIAH1/SIAH2 Antibody
1-CSB-PA004090	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SIAH1/SIAH2. Recognizes SIAH1/SIAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

SIAH1 cloning plasmid
CSB-CL818230HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 849 Sequence: atgagccgtcagactgctacagcattacctaccggtacctcgaagtgtccaccatcccagagggtgcctgccctgactggcacaactgcatccaacaatgacttggcgagtctttttgagtgtccagtctgctttgactatgtgttaccgcccattcttcaatgtcagagtggcca Show more
Description: A cloning plasmid for the SIAH1 gene.

SIAH1 cloning plasmid
CSB-CL818230HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 942 Sequence: atgacgggaaaggctactccaccttctctgtactcctggaggggagtcttgttcacatgtttaccagcggccaggacaaggaagagaaaagaaatgagccgtcagactgctacagcattacctaccggtacctcgaagtgtccaccatcccagagggtgcctgccctgactggcac Show more
Description: A cloning plasmid for the SIAH1 gene.

Anti-SIAH1 antibody
PAab07857	Lifescience Market	100 ug	EUR 412

Anti-SIAH1 antibody
STJ70109	St John's Laboratory	100 µg	EUR 359

Anti-SIAH1 antibody
STJ25527	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized.

Anti-SIAH1 antibody
STJ114364	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized.

Anti-SIAH1 (2C5)
YF-MA15411	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SIAH1

Human E3 ubiquitin- protein ligase SIAH1, SIAH1 ELISA KIT
ELI-42323h	Lifescience Market	96 Tests	EUR 824

Human E3 ubiquitin-protein ligase SIAH1 (SIAH1) ELISA Kit
abx383195-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat E3 ubiquitin-protein ligase SIAH1 (SIAH1) ELISA Kit
abx391267-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SIAH1 Cell ELISA Kit
abx595899-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Rat SIAH1 shRNA Plasmid
20-abx987552	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SIAH1 ELISA KIT|Human
EF002925	Lifescience Market	96 Tests	EUR 689

SIAH1 / 2 Blocking Peptide
20-abx162353	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Human SIAH1 shRNA Plasmid
20-abx954378	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SIAH1 protein (His tag)
80R-2413	Fitzgerald	50 ug	EUR 424
Description: Purified recombinant SIAH1 protein (His tag)

SIAH1 Recombinant Protein (Human)
RP028540	ABM	100 ug	Ask for price

SIAH1 Recombinant Protein (Human)
RP028543	ABM	100 ug	Ask for price

Anti-SIAH1, Biotinylated antibody
STJ73231	St John's Laboratory	100 µg	EUR 359

Siah1 ELISA Kit| Rat E3 ubiquitin-protein ligase SIAH1 ELISA Ki
EF018622	Lifescience Market	96 Tests	EUR 689

Polyclonal Goat Anti-SIAH1 Antibody
APR12175G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SIAH1 . This antibody is tested and proven to work in the following applications:

SIAH1 Colorimetric Cell-Based ELISA
EKC1866	BosterBio	100ul	EUR 572

SIAH1 ORF Vector (Human) (pORF)
ORF009514	ABM	1.0 ug DNA	EUR 95

SIAH1 ORF Vector (Human) (pORF)
ORF009515	ABM	1.0 ug DNA	EUR 95

Polyclonal SIAH1 antibody - N-terminal region
APR13337G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SIAH1 - N-terminal region. This antibody is tested and proven to work in the following applications:

SIAH1 sgRNA CRISPR Lentivector set (Human)
K2146601	ABM	3 x 1.0 ug	EUR 339

SIAH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2146602	ABM	1.0 ug DNA	EUR 154

SIAH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2146603	ABM	1.0 ug DNA	EUR 154

SIAH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2146604	ABM	1.0 ug DNA	EUR 154

SIAH1 Protein Vector (Human) (pPB-C-His)
PV038053	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPB-N-His)
PV038054	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPM-C-HA)
PV038055	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPM-C-His)
PV038056	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPB-C-His)
PV038057	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPB-N-His)
PV038058	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPM-C-HA)
PV038059	ABM	500 ng	EUR 329

SIAH1 Protein Vector (Human) (pPM-C-His)
PV038060	ABM	500 ng	EUR 329

SIAH1 3'UTR Luciferase Stable Cell Line
TU023168	ABM	1.0 ml	EUR 1394

SIAH1 3'UTR GFP Stable Cell Line
TU073168	ABM	1.0 ml	EUR 1394

SIAH1 Colorimetric Cell-Based ELISA Kit (OKAG01389)
OKAG01389	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

SIAH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715023	ABM	1.0 ug DNA	EUR 316