SIAH1 antibody
20R-1085 100 ug
EUR 377
Description: Rabbit polyclonal SIAH1 antibody
SIAH1 antibody
20R-1194 100 ug
EUR 377
Description: Rabbit polyclonal SIAH1 antibody
SIAH1 antibody
70R-20265 50 ul
EUR 435
Description: Rabbit polyclonal SIAH1 antibody
SIAH1 antibody
70R-31987 100 ug
EUR 327
Description: Rabbit polyclonal SIAH1 antibody
SIAH1 Antibody
32672-100ul 100ul
EUR 252
SIAH1 Antibody
43329-100ul 100ul
EUR 252
SIAH1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SIAH1. Recognizes SIAH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SIAH1 Antibody
DF6963 200ul
EUR 304
Description: SIAH1 Antibody detects endogenous levels of total SIAH1.
SIAH1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SIAH1. Recognizes SIAH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
SIAH1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SIAH1. Recognizes SIAH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SIAH1 Antibody
ABD3341 100 ug
EUR 438
SIAH1 Antibody
ABD6963 100 ug
EUR 438
YF-PA24700 50 ul
EUR 334
Description: Mouse polyclonal to SIAH1
Human E3 ubiquitin-protein ligase SIAH1 (SIAH1)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 61.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human E3 ubiquitin-protein ligase SIAH1(SIAH1) expressed in E.coli
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx146887-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx028787-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx028787-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx237857-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
E3 ubiquitin-protein ligase SIAH1 (SIAH1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
abx431586-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
E3 Ubiquitin-Protein Ligase SIAH1 (SIAH1) Antibody (Biotin)
abx431587-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
SIAH1 Rabbit pAb
A12490-100ul 100 ul
EUR 308
SIAH1 Rabbit pAb
A12490-200ul 200 ul
EUR 459
SIAH1 Rabbit pAb
A12490-20ul 20 ul
EUR 183
SIAH1 Rabbit pAb
A12490-50ul 50 ul
EUR 223
SIAH1 Blocking Peptide
33R-3086 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SIAH1 antibody, catalog no. 20R-1085
SIAH1 Blocking Peptide
33R-5522 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SIAH1 antibody, catalog no. 20R-1194
SIAH1/SIAH2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SIAH1/SIAH2. Recognizes SIAH1/SIAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
SIAH1 Blocking Peptide
DF6963-BP 1mg
EUR 195
SIAH1/2 antibody
70R-51810 100 ul
EUR 244
Description: Purified Polyclonal SIAH1/2 antibody
SIAH1 / 2 Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
SIAH1 Conjugated Antibody
C43329 100ul
EUR 397
SIAH1 Conjugated Antibody
C32672 100ul
EUR 397
SIAH1 / SIAH2 Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
SIAH1 cloning plasmid
CSB-CL818230HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atgagccgtcagactgctacagcattacctaccggtacctcgaagtgtccaccatcccagagggtgcctgccctgactggcacaactgcatccaacaatgacttggcgagtctttttgagtgtccagtctgctttgactatgtgttaccgcccattcttcaatgtcagagtggcca
  • Show more
Description: A cloning plasmid for the SIAH1 gene.
SIAH1 cloning plasmid
CSB-CL818230HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atgacgggaaaggctactccaccttctctgtactcctggaggggagtcttgttcacatgtttaccagcggccaggacaaggaagagaaaagaaatgagccgtcagactgctacagcattacctaccggtacctcgaagtgtccaccatcccagagggtgcctgccctgactggcac
  • Show more
Description: A cloning plasmid for the SIAH1 gene.
SIAH1 Rabbit pAb
A2494-100ul 100 ul
EUR 308
SIAH1 Rabbit pAb
A2494-200ul 200 ul
EUR 459
SIAH1 Rabbit pAb
A2494-20ul 20 ul
EUR 183
SIAH1 Rabbit pAb
A2494-50ul 50 ul
EUR 223
anti- SIAH1 antibody
FNab07857 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: seven in absentia homolog 1 (Drosophila)
  • Uniprot ID: Q8IUQ4
  • Gene ID: 6477
  • Research Area: Neuroscience, Epigenetics, Metabolism, Developmental biology
Description: Antibody raised against SIAH1
Anti-SIAH1 antibody
PAab07857 100 ug
EUR 412
Anti-SIAH1 (2C5)
YF-MA15411 100 ug
EUR 363
Description: Mouse monoclonal to SIAH1
Anti-SIAH1 antibody
STJ25527 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized.
Anti-SIAH1 antibody
STJ114364 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the seven in absentia homolog (SIAH) family. The protein is an E3 ligase and is involved in ubiquitination and proteasome-mediated degradation of specific proteins. The activity of this ubiquitin ligase has been implicated in the development of certain forms of Parkinson's disease, the regulation of the cellular response to hypoxia and induction of apoptosis. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized.
Anti-SIAH1 antibody
STJ70109 100 µg
EUR 359
Human E3 ubiquitin- protein ligase SIAH1, SIAH1 ELISA KIT
ELI-42323h 96 Tests
EUR 824
Rat E3 ubiquitin-protein ligase SIAH1 (SIAH1) ELISA Kit
abx391267-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human E3 ubiquitin-protein ligase SIAH1 (SIAH1) ELISA Kit
abx383195-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SIAH1 protein (His tag)
80R-2413 50 ug
EUR 424
Description: Purified recombinant SIAH1 protein (His tag)
SIAH1 / 2 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
EF002925 96 Tests
EUR 689
Rat SIAH1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
abx595899-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Human SIAH1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SIAH1, Biotinylated antibody
STJ73231 100 µg
EUR 359
SIAH1 Recombinant Protein (Human)
RP028540 100 ug Ask for price
SIAH1 Recombinant Protein (Human)
RP028543 100 ug Ask for price
Siah1 ELISA Kit| Rat E3 ubiquitin-protein ligase SIAH1 ELISA Ki
EF018622 96 Tests
EUR 689
SIAH1 Colorimetric Cell-Based ELISA
EKC1866 100ul
EUR 572
Polyclonal Goat Anti-SIAH1 Antibody
APR12175G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SIAH1 . This antibody is tested and proven to work in the following applications:
SIAH1 ORF Vector (Human) (pORF)
ORF009514 1.0 ug DNA
EUR 95
SIAH1 ORF Vector (Human) (pORF)
ORF009515 1.0 ug DNA
EUR 95
Polyclonal SIAH1 antibody - N-terminal region
APR13337G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SIAH1 - N-terminal region. This antibody is tested and proven to work in the following applications:
SIAH1 sgRNA CRISPR Lentivector set (Human)
K2146601 3 x 1.0 ug
EUR 339
SIAH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2146602 1.0 ug DNA
EUR 154
SIAH1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2146603 1.0 ug DNA
EUR 154
SIAH1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2146604 1.0 ug DNA
EUR 154
SIAH1 Colorimetric Cell-Based ELISA Kit (OKAG01389)
OKAG01389 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
SIAH1 3'UTR Luciferase Stable Cell Line
TU023168 1.0 ml
EUR 1394
SIAH1 3'UTR GFP Stable Cell Line
TU073168 1.0 ml
EUR 1394
SIAH1 Protein Vector (Human) (pPB-C-His)
PV038053 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPB-N-His)
PV038054 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPM-C-HA)
PV038055 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPM-C-His)
PV038056 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPB-C-His)
PV038057 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPB-N-His)
PV038058 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPM-C-HA)
PV038059 500 ng
EUR 329
SIAH1 Protein Vector (Human) (pPM-C-His)
PV038060 500 ng
EUR 329
SIAH1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715023 1.0 ug DNA
EUR 316