SERPINA1 Antibody
32119-100ul 100ul
EUR 252
SERPINA1 antibody
10R-5726 100 ul
EUR 691
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 antibody
10R-5727 100 ul
EUR 691
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 antibody
10R-5728 100 ul
EUR 691
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 antibody
10R-5729 100 ul
EUR 726
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 antibody
10R-5730 100 ul
EUR 691
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 antibody
10R-5731 100 ul
EUR 691
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 antibody
10R-5732 100 ul
EUR 691
Description: Mouse monoclonal SERPINA1 antibody
SERPINA1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
SERPINA1 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
SERPINA1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
SERPINA1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
SERPINA1 Antibody
DF6182 200ul
EUR 304
Description: SERPINA1 Antibody detects endogenous levels of total SERPINA1.
SERPINA1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
SERPINA1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
SERPINA1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Serpina1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SERPINA1 Antibody
ABD6182 100 ug
EUR 438
SERPINA1 Rabbit pAb
A1015-100ul 100 ul
EUR 308
SERPINA1 Rabbit pAb
A1015-200ul 200 ul
EUR 459
SERPINA1 Rabbit pAb
A1015-20ul 20 ul
EUR 183
SERPINA1 Rabbit pAb
A1015-50ul 50 ul
EUR 223
SERPINA1 Rabbit pAb
A12481-100ul 100 ul
EUR 308
SERPINA1 Rabbit pAb
A12481-200ul 200 ul
EUR 459
SERPINA1 Rabbit pAb
A12481-20ul 20 ul
EUR 183
SERPINA1 Rabbit pAb
A12481-50ul 50 ul
EUR 223
SERPINA1 Blocking Peptide
DF6182-BP 1mg
EUR 195
SERPINA1 Conjugated Antibody
C32119 100ul
EUR 397
SERPINA1 cloning plasmid
CSB-CL021053HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1257
  • Sequence: atgccgtcttctgtctcgtggggcatcctcctgctggcaggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccagaagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaacctggctgagttcgcct
  • Show more
Description: A cloning plasmid for the SERPINA1 gene.
SERPINA1 Polyclonal Antibody
A64152 100 µg
EUR 570.55
Description: reagents widely cited
Serpina1 Polyclonal Antibody
A55133 100 µg
EUR 570.55
Description: reagents widely cited
Recombinant Human SERPINA1
P0481 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P01009
Description: Recombinant Human protein for SERPINA1
Anti-SERPINA1 antibody
STJ25480 100 µl
EUR 277
Description: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.
Anti-SERPINA1 antibody
STJ114355 100 µl
EUR 277
Description: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.
Anti-SERPINA1 antibody
STJ400000 1 mg
EUR 446
Description: AAT is a glycoprotein that protects the lungs from the destructive actions of blood enzymes. Disorders of this protein include AAT-deficiency leading to chronic uninhibited tissue breakdown.
Anti-SERPINA1 antibody
STJ400001 1 mg
EUR 446
Description: AAT is a glycoprotein that protects the lungs from the destructive actions of blood enzymes. Disorders of this protein include AAT-deficiency leading to chronic uninhibited tissue breakdown.
SERPINA1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SERPINA1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SERPINA1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SERPINA1. Recognizes SERPINA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Polyclonal SERPINA1 Antibody (Center)
AMR09901G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SERPINA1 (Center). This antibody is tested and proven to work in the following applications:
Serpin A1 (SERPINA1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Serpin A1 (SERPINA1) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
ELA-E1697h 96 Tests
EUR 824
Rat SERPINA1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Serpina1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA
Serpina1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA
Serpina1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Serpina1. Recognizes Serpina1 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SERPINA1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SERPINA1 recombinant monoclonal antibody
A5706 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human SERPINA1 for WB, IHC,ELISA
SERPINA1 Recombinant Protein (Human)
RP028120 100 ug Ask for price
Rat Alpha-1-antiproteinase (Serpina1)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 59.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Alpha-1-antiproteinase(Serpina1) expressed in E.coli
Rat Alpha-1-antiproteinase (Serpina1)
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 45.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Alpha-1-antiproteinase(Serpina1) expressed in Yeast
Monoclonal SERPINA1 Antibody, Clone: 6F9H11
AMR09899G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SERPINA1. The antibodies are raised in Mouse and are from clone 6F9H11. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal SERPINA1 Antibody, Clone: 5D1D2
AMR09900G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human SERPINA1. The antibodies are raised in Mouse and are from clone 5D1D2. This antibody is applicable in WB and IHC, FC, ICC, E
alpha 1 Antitrypsin (SERPINA1) Antibody
abx022446-1mg 1 mg
EUR 648
  • Shipped within 5-10 working days.
alpha 1 Antitrypsin (SERPINA1) Antibody
abx022447-1mg 1 mg
EUR 871
  • Shipped within 5-10 working days.
alpha 1 Antitrypsin (SERPINA1) Antibody
abx023901-02mg 0.2 mg
EUR 578
  • Shipped within 5-10 working days.
alpha 1-Antitrypsin (SERPINA1) Antibody
abx019008-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx218526-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx224268-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
alpha 1-Antiproteinase (Serpina1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx034372-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx034372-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx411121-1mg 1 mg
EUR 801
  • Shipped within 1 week.
alpha-1-Antitrypsin (SERPINA1) Antibody
abx432314-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
alpha-1-Antitrypsin (SERPINA1) Antibody
abx432315-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx224395-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx230337-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Alpha-1-Antitrypsin (SERPINA1) Antibody
abx230338-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
SERPINA1 Polyclonal Antibody, HRP Conjugated
A64153 100 µg
EUR 570.55
Description: Ask the seller for details
SERPINA1 Polyclonal Antibody, FITC Conjugated
A64154 100 µg
EUR 570.55
Description: The best epigenetics products
SERPINA1 Polyclonal Antibody, Biotin Conjugated
A64155 100 µg
EUR 570.55
Description: kits suitable for this type of research
Serpina1 Polyclonal Antibody, Biotin Conjugated
A55130 100 µg
EUR 570.55
Description: fast delivery possible
Serpina1 Polyclonal Antibody, FITC Conjugated
A55131 100 µg
EUR 570.55
Description: reagents widely cited
Serpina1 Polyclonal Antibody, HRP Conjugated
A55132 100 µg
EUR 570.55
Description: Ask the seller for details
Alpha-1-Antitrypsin (SERPINA1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Serpina1 ORF Vector (Rat) (pORF)
ORF076059 1.0 ug DNA
EUR 506
SERPINA1 ORF Vector (Human) (pORF)
ORF009374 1.0 ug DNA
EUR 95
SERPINA1 ELISA Kit (Rat) (OKCD07605)
OKCD07605 96 Wells
EUR 1001
Description: Description of target: SERPINA1 is also known as PI, A1A or AAT. The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 3.5ng/mL
SERPINA1 ELISA Kit (Bovine) (OKEH08414)
OKEH08414 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.051ng/ml
SERPINA1 ELISA Kit (Human) (OKAN04443)
OKAN04443 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 2.83 ng/mL