  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEMA5B Polyclonal Antibody
28364-100ul 100ul
EUR 252
SEMA5B Polyclonal Antibody
28364-50ul 50ul
EUR 187
SEMA5B Rabbit pAb
A13819-100ul 100 ul
EUR 308
SEMA5B Rabbit pAb
A13819-200ul 200 ul
EUR 459
SEMA5B Rabbit pAb
A13819-20ul 20 ul
EUR 183
SEMA5B Rabbit pAb
A13819-50ul 50 ul
EUR 223
SEMA5B cloning plasmid
CSB-CL868389HU-10ug 10ug
EUR 1227
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3456
  • Sequence: atgccctgtggcttcagtccgtctcctgttgcccaccacctcgtccctgggccgcctgataccccagcccaacagctaaggtgtggatggacagtagggggctggcttctctcactggtcaggggtcttctcccctgtctgcctcccggagctaggactgcagaggggcctatca
  • Show more
Description: A cloning plasmid for the SEMA5B gene.
Anti-SEMA5B antibody
STJ115761 100 µl
EUR 277
Description: This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene.
SEMA5B Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5B. Recognizes SEMA5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEMA5B Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5B. Recognizes SEMA5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEMA5B Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5B. Recognizes SEMA5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Semaphorin 5B (SEMA5B) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Semaphorin 5B (SEMA5B) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Semaphorin 5B (SEMA5B) Antibody
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Semaphorin 5B (SEMA5B) Antibody
  • EUR 356.00
  • EUR 926.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse SEMA5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEMA5B Polyclonal Conjugated Antibody
C28364 100ul
EUR 397
Semaphorin 5B (SEMA5B) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human SEMA5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Recombinant Semaphorin 5B (SEMA5B)
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9P283
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.9kDa
  • Isoelectric Point: 6
Description: Recombinant Human Semaphorin 5B expressed in: E.coli
Recombinant Semaphorin 5B (SEMA5B)
  • EUR 377.76
  • EUR 204.00
  • EUR 1141.60
  • EUR 447.20
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9P283
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.5kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Semaphorin 5B expressed in: E.coli
Recombinant Semaphorin 5B (SEMA5B)
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q60519
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Semaphorin 5B expressed in: E.coli
Human Semaphorin 5B (SEMA5B) Protein
  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Semaphorin 5B (SEMA5B) Protein
  • EUR 537.00
  • EUR 244.00
  • EUR 1553.00
  • EUR 634.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Semaphorin 5B (SEMA5B) Protein
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Semaphorin 5B (SEMA5B) Antibody (Biotin)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Semaphorin 5B (SEMA5B) Antibody (Biotin)
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Semaphorin 5B (SEMA5B) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Semaphorin 5B (SEMA5B) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Semaphorin 5B (SEMA5B) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sema5b ORF Vector (Rat) (pORF)
ORF076013 1.0 ug DNA
EUR 506
SEMA5B ORF Vector (Human) (pORF)
ORF009336 1.0 ug DNA
EUR 95
Sema5b ORF Vector (Mouse) (pORF)
ORF056912 1.0 ug DNA
EUR 506
SEMA5B ELISA Kit (Human) (OKCD09338)
OKCD09338 96 Wells
EUR 909
Description: Description of target: This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.133ng/mL
Human Semaphorin 5B (SEMA5B)ELISA Kit
201-12-2276 96 tests
EUR 440
  • This Semaphorin 5B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Mouse Semaphorin- 5B, Sema5b ELISA KIT
ELI-29661m 96 Tests
EUR 865
Human Semaphorin 5B (SEMA5B) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Semaphorin- 5B, SEMA5B ELISA KIT
ELI-35821h 96 Tests
EUR 824
Sema5b sgRNA CRISPR Lentivector set (Mouse)
K4666201 3 x 1.0 ug
EUR 339
Sema5b sgRNA CRISPR Lentivector set (Rat)
K6350401 3 x 1.0 ug
EUR 339
SEMA5B sgRNA CRISPR Lentivector set (Human)
K2117201 3 x 1.0 ug
EUR 339
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human)
  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B)
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human)
  • EUR 274.00
  • EUR 2945.00
  • EUR 724.00
  • EUR 349.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B)
Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Semaphorin 5B (SEMA5B) ELISA Kit
SEL926Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5B (SEMA5B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5B (SEMA5B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
Human Semaphorin 5B (SEMA5B) ELISA Kit
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Semaphorin 5B elisa. Alternative names of the recognized antigen: SEMAG
  • SemG
  • Sema Domain, Immunoglobulin Domain(Ig), Transmembrane Domain(TM)and Short Cytoplasmic Domain 5B
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Semaphorin 5B (SEMA5B) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human Semaphorin 5B(SEMA5B)ELISA Kit
QY-E00789 96T
EUR 361
Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human)
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SEMA5B (Leu36~Glu161)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B)
Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human)
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SEMA5B (Gly350~Pro602)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B)
Semaphorin 5B (SEMA5B) Polyclonal Antibody (Human)
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Semaphorin 5B (SEMA5B)
Semaphorin 5B (SEMA5B) Polyclonal Antibody (Mouse)
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SEMA5B (Gly836~Leu1013)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Semaphorin 5B (SEMA5B)
Sema5b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4666202 1.0 ug DNA
EUR 154
Sema5b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4666203 1.0 ug DNA
EUR 154
Sema5b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4666204 1.0 ug DNA
EUR 154
Sema5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6350402 1.0 ug DNA
EUR 154
Sema5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6350403 1.0 ug DNA
EUR 154
Sema5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6350404 1.0 ug DNA
EUR 154
SEMA5B sgRNA CRISPR Lentivector (Human) (Target 1)
K2117202 1.0 ug DNA
EUR 154
SEMA5B sgRNA CRISPR Lentivector (Human) (Target 2)
K2117203 1.0 ug DNA
EUR 154
SEMA5B sgRNA CRISPR Lentivector (Human) (Target 3)
K2117204 1.0 ug DNA
EUR 154
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), APC
  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with APC.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Biotinylated
  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Biotin.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Cy3
  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Cy3.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), FITC
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with FITC.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), HRP
  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with HRP.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), PE
  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with PE.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), APC
  • EUR 386.00
  • EUR 3869.00
  • EUR 1061.00
  • EUR 499.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with APC.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Biotinylated
  • EUR 342.00
  • EUR 2895.00
  • EUR 836.00
  • EUR 424.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Biotin.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), Cy3
  • EUR 474.00
  • EUR 5117.00
  • EUR 1373.00
  • EUR 624.00
  • EUR 274.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with Cy3.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), FITC
  • EUR 329.00
  • EUR 3115.00
  • EUR 868.00
  • EUR 419.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with FITC.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), HRP
  • EUR 351.00
  • EUR 3369.00
  • EUR 936.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with HRP.
Semaphorin 5B (SEMA5B) Monoclonal Antibody (Human), PE
  • EUR 329.00
  • EUR 3115.00
  • EUR 868.00
  • EUR 419.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly350~Pro602
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Semaphorin 5B (SEMA5B). This antibody is labeled with PE.
SEMA5B 3'UTR Luciferase Stable Cell Line
TU022876 1.0 ml
EUR 1394
Sema5b 3'UTR Luciferase Stable Cell Line
TU118542 1.0 ml Ask for price
Sema5b 3'UTR GFP Stable Cell Line
TU168542 1.0 ml Ask for price
Sema5b 3'UTR Luciferase Stable Cell Line
TU220109 1.0 ml Ask for price
Sema5b 3'UTR GFP Stable Cell Line
TU270109 1.0 ml Ask for price
SEMA5B 3'UTR GFP Stable Cell Line
TU072876 1.0 ml
EUR 1394
SEMA5B Protein Vector (Rat) (pPB-C-His)
PV304050 500 ng
EUR 1166
SEMA5B Protein Vector (Rat) (pPB-N-His)
PV304051 500 ng
EUR 1166
SEMA5B Protein Vector (Rat) (pPM-C-HA)
PV304052 500 ng
EUR 1166