SEMA5A

Human Semaphorin 5A (SEMA5A) ELISA Kit
DLR-SEMA5A-Hu-96T	DL Develop	96T	EUR 725
Should the Human Semaphorin 5A (SEMA5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Semaphorin 5A (SEMA5A) in samples from tissue homogenates or other biological fluids.

Human Semaphorin 5A (SEMA5A) ELISA Kit
RD-SEMA5A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Semaphorin 5A (SEMA5A) ELISA Kit
RD-SEMA5A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Semaphorin 5A (SEMA5A) ELISA Kit
RDR-SEMA5A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Semaphorin 5A (SEMA5A) ELISA Kit
RDR-SEMA5A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

SEMA5A Antibody
1-CSB-PA613413LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5A. Recognizes SEMA5A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500

SEMA5A siRNA
20-abx932853	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEMA5A siRNA
20-abx932854	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEMA5A Polyclonal Antibody
28714-100ul	SAB	100ul	EUR 252

SEMA5A Polyclonal Antibody
28714-50ul	SAB	50ul	EUR 187

M Sema5a Antibody
abx031644-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

M Sema5a Antibody
abx031644-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

M Sema5a Antibody
abx031645-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

M Sema5a Antibody
abx031645-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SEMA5A cloning plasmid
CSB-CL613413HU-10ug	Cusabio	10ug	EUR 1185
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3225 Sequence: ATGAAGGGAACCTGTGTTATAGCATGGCTGTTCTCAAGCCTGGGGCTGTGGAGACTCGCCCACCCAGAGGCCCAGGGTACGACTCAGTGCCAGAGAACCGAGCATCCAGTCATCTCCTATAAAGAAATTGGCCCCTGGTTACGGGAGTTCAGAGCGAAGAATGCTGTGGATTTCT Show more
Description: A cloning plasmid for the SEMA5A gene.

SEMA5A Polyclonal Antibody
A64642	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SEMA5A Rabbit pAb
A14817-100ul	Abclonal	100 ul	EUR 308

SEMA5A Rabbit pAb
A14817-200ul	Abclonal	200 ul	EUR 459

SEMA5A Rabbit pAb
A14817-20ul	Abclonal	20 ul	EUR 183

SEMA5A Rabbit pAb
A14817-50ul	Abclonal	50 ul	EUR 223

Anti-SEMA5A antibody
STJ117017	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.

SEMA5A Antibody, HRP conjugated
1-CSB-PA613413LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5A. Recognizes SEMA5A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEMA5A Antibody, FITC conjugated
1-CSB-PA613413LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5A. Recognizes SEMA5A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEMA5A Antibody, Biotin conjugated
1-CSB-PA613413LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEMA5A. Recognizes SEMA5A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Semaphorin 5A (SEMA5A) Antibody
20-abx178355	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Semaphorin 5A (SEMA5A) Antibody
20-abx174506	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Semaphorin 5A (SEMA5A) Antibody
abx031646-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Semaphorin 5A (SEMA5A) Antibody
abx031646-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Human SEMA5A ELISA Kit
ELA-E1512h	Lifescience Market	96 Tests	EUR 824

SEMA5A ELISA KIT|Human
EF005912	Lifescience Market	96 Tests	EUR 689

Rat SEMA5A shRNA Plasmid
20-abx989593	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal M Sema5a Antibody
APR12486G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human M Sema5a . This antibody is tested and proven to work in the following applications:

SEMA5A Polyclonal Conjugated Antibody
C28714	SAB	100ul	EUR 397

Semaphorin 5A (SEMA5A) Antibody
abx431581-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Semaphorin 5A (SEMA5A) Antibody
20-abx306749	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human SEMA5A shRNA Plasmid
20-abx955960	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Semaphorin 5A (SEMA5A) Protein
20-abx655031	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Semaphorin 5A (SEMA5A) Antibody (HRP)
20-abx306750	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Semaphorin 5A (SEMA5A) Antibody (FITC)
20-abx306751	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Semaphorin 5A (SEMA5A) Antibody (Biotin)
20-abx306752	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEMA5A Polyclonal Antibody, HRP Conjugated
A64643	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SEMA5A Polyclonal Antibody, FITC Conjugated
A64644	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SEMA5A Polyclonal Antibody, Biotin Conjugated
A64645	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Sema5a ORF Vector (Rat) (pORF)
ORF076012	ABM	1.0 ug DNA	EUR 506

SEMA5A ORF Vector (Human) (pORF)
ORF014394	ABM	1.0 ug DNA	EUR 354

Sema5a ORF Vector (Mouse) (pORF)
ORF056911	ABM	1.0 ug DNA	EUR 506

SEMA5A ELISA Kit (Human) (OKEH04208)
OKEH04208	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

SEMA5A ELISA Kit (Human) (OKCD09337)
OKCD09337	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.31ng/mL

SEMA5A ELISA Kit (Mouse) (OKEH05427)
OKEH05427	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Bifunctional axonal guidance cue regulated by sulfated proteoglycans; attractive effects result from interactions with heparan sulfate proteoglycans (HSPGs), while the inhibitory effects depend on interactions with chondroitin sulfate proteoglycans (CSPGs). Ligand for receptor PLXNB3. In glioma cells, SEMA5A stimulation of PLXNB3 results in the disassembly of F-actin stress fibers, disruption of focal adhesions and cellular collapse as well as inhibition of cell migration and invasion through ARHGDIA-mediated inactivation of RAC1. May promote angiogenesis by increasing endothelial cell proliferation and migration and inhibiting apoptosis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

SEMA5A ELISA Kit (Human) (OKAN06624)
OKAN06624	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.31 ng/mL

Human Semaphorin 5A (SEMA5A)ELISA Kit
201-12-1946	SunredBio	96 tests	EUR 440
This Semaphorin 5A ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Semaphorin 5A (SEMA5A) ELISA Kit
20-abx153053	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Semaphorin 5A (SEMA5A) ELISA Kit
abx251082-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human SEMA5A/ Semaphorin-5A ELISA Kit
E2240Hu	Sunlong	1 Kit	EUR 571

Human SEMA5A(Semaphorin-5A) ELISA Kit
EH1776	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q13591 Alias: SEMA5A/Semaphorin-5A/Semaphorin-F/Sema F/SEMAF/semaphorin F/SEMF/transmembrane domain(TM) and short cytoplasmic domain,(semaphorin) 5A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Semaphorin- 5A, Sema5a ELISA KIT
ELI-04992m	Lifescience Market	96 Tests	EUR 865

Human Semaphorin- 5A, SEMA5A ELISA KIT
ELI-04993h	Lifescience Market	96 Tests	EUR 824

Polyclonal M Sema5a Antibody (N-term)
APR11274G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human M Sema5a (N-term). This antibody is tested and proven to work in the following applications:

Human Semaphorin 5A (SEMA5A) ELISA Kit
abx573582-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Semaphorin 5A (SEMA5A) ELISA Kit
abx517654-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Semaphorin 5A (SEMA5A) CLIA Kit
20-abx495991	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Semaphorin 5A(SEMA5A)ELISA Kit
GA-E1962HM-48T	GenAsia Biotech	48T	EUR 289

Human Semaphorin 5A(SEMA5A)ELISA Kit
GA-E1962HM-96T	GenAsia Biotech	96T	EUR 466

Sema5a sgRNA CRISPR Lentivector set (Rat)
K6403701	ABM	3 x 1.0 ug	EUR 339

Sema5a sgRNA CRISPR Lentivector set (Mouse)
K4529301	ABM	3 x 1.0 ug	EUR 339

SEMA5A sgRNA CRISPR Lentivector set (Human)
K2117101	ABM	3 x 1.0 ug	EUR 339

Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.

Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.

Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.

Human Semaphorin 5A (SEMA5A) ELISA Kit
SEL924Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Semaphorin 5A (SEMA5A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Semaphorin 5A (SEMA5A) in tissue homogenates, cell lysates and other biological fluids.

Human Semaphorin 5A (SEMA5A) ELISA Kit
4-SEL924Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Semaphorin 5A elisa. Alternative names of the recognized antigen: SEMAF SemF Semaphorin-F Sema Domain, Immunoglobulin Domain(Ig), Transmembrane Domain(TM)and Short Cytoplasmic Domain 5A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Semaphorin 5A (SEMA5A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Semaphorin 5A(SEMA5A)ELISA Kit
QY-E00790	Qayee Biotechnology	96T	EUR 361

Human Semaphorin 5A ELISA Kit (SEMA5A)
RK02265	Abclonal	96 Tests	EUR 521

Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.

Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.

Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.

Recombinant Human Semaphorin-5A/SEMA5A (C-6His)
C499-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 0.1mM EDTA, 0.05% Tween 20, pH 7.2.

ELISA kit for Human SEMA5A (Semaphorin 5A)
ELK6672	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Semaphorin 5A (SEMA5A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Semaphorin Show more
Description: A sandwich ELISA kit for detection of Semaphorin 5A from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Semaphorin-5A (SEMA5A)
KTE62333-48T	Abbkine	48T	EUR 332
SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been Show more
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Semaphorin-5A (SEMA5A)
KTE62333-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been Show more
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Semaphorin-5A (SEMA5A)
KTE62333-96T	Abbkine	96T	EUR 539
SEMA5A belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been Show more
Description: Quantitative sandwich ELISA for measuring Human Semaphorin-5A (SEMA5A) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sema5a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6403702	ABM	1.0 ug DNA	EUR 154

Sema5a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6403703	ABM	1.0 ug DNA	EUR 154

Sema5a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6403704	ABM	1.0 ug DNA	EUR 154

Sema5a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4529302	ABM	1.0 ug DNA	EUR 154