SEC61G Antibody
DF12136 200ul
EUR 304
Description: SEC61G antibody detects endogenous levels of SEC61G.
SEC61G Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SEC61G Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEC61G Blocking Peptide
DF12136-BP 1mg
EUR 195
SEC61G cloning plasmid
CSB-CL020959HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atggatcaggtaatgcagtttgttgagccaagtcggcagtttgtaaaggactccattcggctggttaaaagatgcactaaacctgatagaaaagaattccagaagattgccatggcaacagcaataggatttgctataatgggattcattggcttctttgtgaaattgatccatat
  • Show more
Description: A cloning plasmid for the SEC61G gene.
SEC61G Polyclonal Antibody
A60846 100 µg
EUR 570.55
Description: fast delivery possible
anti- SEC61G antibody
FNab07692 100µg
EUR 548.75
  • Immunogen: Sec61 gamma subunit
  • Uniprot ID: P60059
  • Gene ID: 23480
  • Research Area: Metabolism
Description: Antibody raised against SEC61G
Anti-SEC61G antibody
PAab07692 100 ug
EUR 386
SEC61G Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEC61G Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEC61G Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC61G. Recognizes SEC61G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse Sec61g ELISA KIT
ELI-13406m 96 Tests
EUR 865
ELI-15491h 96 Tests
EUR 824
ELI-29480b 96 Tests
EUR 928
EF002797 96 Tests
EUR 689
Mouse SEC61G shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SEC61G shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-40861d 96 Tests
EUR 928
SEC61G Recombinant Protein (Human)
RP027925 100 ug Ask for price
SEC61G Recombinant Protein (Rat)
RP227921 100 ug Ask for price
SEC61G Recombinant Protein (Mouse)
RP170597 100 ug Ask for price
SEC61G Recombinant Protein (Mouse)
RP170600 100 ug Ask for price
SEC61G Recombinant Protein (Mouse)
RP170603 100 ug Ask for price
SEC61G Polyclonal Antibody, Biotin Conjugated
A60847 100 µg
EUR 570.55
Description: reagents widely cited
SEC61G Polyclonal Antibody, FITC Conjugated
A60848 100 µg
EUR 570.55
Description: Ask the seller for details
SEC61G Polyclonal Antibody, HRP Conjugated
A60849 100 µg
EUR 570.55
Description: The best epigenetics products
Sec61g ORF Vector (Rat) (pORF)
ORF075975 1.0 ug DNA
EUR 506
SEC61G ORF Vector (Human) (pORF)
ORF009309 1.0 ug DNA
EUR 95
Sec61g ORF Vector (Mouse) (pORF)
ORF056867 1.0 ug DNA
EUR 506
Sec61g ORF Vector (Mouse) (pORF)
ORF056868 1.0 ug DNA
EUR 506
Sec61g ORF Vector (Mouse) (pORF)
ORF056869 1.0 ug DNA
EUR 506
Sec61 Translocon Gamma Subunit (SEC61G) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec61 Translocon Gamma Subunit (SEC61G) Antibody
abx237692-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sec61g sgRNA CRISPR Lentivector set (Rat)
K6065701 3 x 1.0 ug
EUR 339
Sec61g sgRNA CRISPR Lentivector set (Mouse)
K4975501 3 x 1.0 ug
EUR 339
SEC61G sgRNA CRISPR Lentivector set (Human)
K2114401 3 x 1.0 ug
EUR 339
Sec61 Translocon Gamma Subunit (SEC61G) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec61 Translocon Gamma Subunit (SEC61G) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec61 Translocon Gamma Subunit (SEC61G) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec61g sgRNA CRISPR Lentivector (Rat) (Target 1)
K6065702 1.0 ug DNA
EUR 154
Sec61g sgRNA CRISPR Lentivector (Rat) (Target 2)
K6065703 1.0 ug DNA
EUR 154
Sec61g sgRNA CRISPR Lentivector (Rat) (Target 3)
K6065704 1.0 ug DNA
EUR 154
Sec61g sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4975502 1.0 ug DNA
EUR 154
Sec61g sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4975503 1.0 ug DNA
EUR 154
Sec61g sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4975504 1.0 ug DNA
EUR 154
SEC61G sgRNA CRISPR Lentivector (Human) (Target 1)
K2114402 1.0 ug DNA
EUR 154
SEC61G sgRNA CRISPR Lentivector (Human) (Target 2)
K2114403 1.0 ug DNA
EUR 154
SEC61G sgRNA CRISPR Lentivector (Human) (Target 3)
K2114404 1.0 ug DNA
EUR 154
SEC61G 3'UTR Luciferase Stable Cell Line
TU022847 1.0 ml
EUR 1394
Sec61g 3'UTR Luciferase Stable Cell Line
TU118509 1.0 ml Ask for price
Sec61g 3'UTR GFP Stable Cell Line
TU168509 1.0 ml Ask for price
Sec61g 3'UTR Luciferase Stable Cell Line
TU220071 1.0 ml Ask for price
Sec61g 3'UTR GFP Stable Cell Line
TU270071 1.0 ml Ask for price
SEC61G 3'UTR GFP Stable Cell Line
TU072847 1.0 ml
EUR 1394
SEC61G Protein Vector (Rat) (pPB-C-His)
PV303898 500 ng
EUR 603
SEC61G Protein Vector (Rat) (pPB-N-His)
PV303899 500 ng
EUR 603
SEC61G Protein Vector (Rat) (pPM-C-HA)
PV303900 500 ng
EUR 603
SEC61G Protein Vector (Rat) (pPM-C-His)
PV303901 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPB-C-His)
PV227466 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPB-N-His)
PV227467 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPM-C-HA)
PV227468 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPM-C-His)
PV227469 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPB-C-His)
PV227470 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPB-N-His)
PV227471 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPM-C-HA)
PV227472 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPM-C-His)
PV227473 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPB-C-His)
PV227474 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPB-N-His)
PV227475 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPM-C-HA)
PV227476 500 ng
EUR 603
SEC61G Protein Vector (Mouse) (pPM-C-His)
PV227477 500 ng
EUR 603
SEC61G Protein Vector (Human) (pPB-C-His)
PV037233 500 ng
EUR 329
SEC61G Protein Vector (Human) (pPB-N-His)
PV037234 500 ng
EUR 329
SEC61G Protein Vector (Human) (pPM-C-HA)
PV037235 500 ng
EUR 329
SEC61G Protein Vector (Human) (pPM-C-His)
PV037236 500 ng
EUR 329
Human Sec61 Translocon Gamma Subunit (SEC61G) ELISA Kit
abx383091-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6065705 3 x 1.0 ug
EUR 376
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4975505 3 x 1.0 ug
EUR 376
SEC61G sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2114405 3 x 1.0 ug
EUR 376
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6065706 1.0 ug DNA
EUR 167
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6065707 1.0 ug DNA
EUR 167
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6065708 1.0 ug DNA
EUR 167
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4975506 1.0 ug DNA
EUR 167
Sec61g sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4975507 1.0 ug DNA
EUR 167