SEC24A

SEC24A siRNA
20-abx932775	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC24A siRNA
20-abx932776	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC24A Antibody
DF12315	Affbiotech	200ul	EUR 304
Description: SEC24A antibody detects endogenous levels of SEC24A.

SEC24A Antibody
1-CSB-PA020950GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC24A. Recognizes SEC24A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Human Protein transport protein Sec24A, SEC24A ELISA KIT
ELI-53195h	Lifescience Market	96 Tests	EUR 824

Mouse Protein transport protein Sec24A, Sec24a ELISA KIT
ELI-29750m	Lifescience Market	96 Tests	EUR 865

Bovine Protein transport protein Sec24A, SEC24A ELISA KIT
ELI-40854b	Lifescience Market	96 Tests	EUR 928

SEC24A cloning plasmid
CSB-CL020950HU-10ug	Cusabio	10ug	EUR 625
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1842 Sequence: atgtcccagccgggaataccggcctccggcggcgccccagccagcctccaggcccagaacggagccgccttggcctcggggtctccctacaccaacggtcctgtccaaaatgcattgctgtcttcacaagagtcagtgagccaaggatacaatttccagcttccaggatcctacc Show more
Description: A cloning plasmid for the SEC24A gene.

anti- SEC24A antibody
FNab07681	FN Test	100µg	EUR 548.75
Immunogen: SEC24 family, member A(S. cerevisiae) Uniprot ID: O95486 Gene ID: 10802 Research Area: Metabolism
Description: Antibody raised against SEC24A

SEC24A Blocking Peptide
DF12315-BP	Affbiotech	1mg	EUR 195

Anti-SEC24A antibody
PAab07681	Lifescience Market	100 ug	EUR 386

pOTB7-SEC24A Plasmid
PVTB00918	Lifescience Market	2 ug	EUR 356

Anti-SEC24A Antibody
STJ502894	St John's Laboratory	100 µg	EUR 476

Anti-SEC24A (4D9)
YF-MA20500	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SEC24A

Mouse SEC24A shRNA Plasmid
20-abx978780	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC24A ELISA KIT|Human
EF002790	Lifescience Market	96 Tests	EUR 689

Human SEC24A shRNA Plasmid
20-abx957362	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-SEC24A Antibody BIOTIN
STJ502895	St John's Laboratory	100 µg	EUR 586

Anti-SEC24A Antibody FITC
STJ502896	St John's Laboratory	100 µg	EUR 586

SEC24A ORF Vector (Human) (pORF)
ORF009302	ABM	1.0 ug DNA	EUR 95

Sec24a ORF Vector (Mouse) (pORF)
ORF056857	ABM	1.0 ug DNA	EUR 506

Sec24a ORF Vector (Rat) (pORF)
ORF075966	ABM	1.0 ug DNA	EUR 506

SEC24A sgRNA CRISPR Lentivector set (Human)
K2113501	ABM	3 x 1.0 ug	EUR 339

Sec24a sgRNA CRISPR Lentivector set (Mouse)
K4605501	ABM	3 x 1.0 ug	EUR 339

Sec24a sgRNA CRISPR Lentivector set (Rat)
K6571501	ABM	3 x 1.0 ug	EUR 339

SEC24A sgRNA CRISPR Lentivector (Human) (Target 1)
K2113502	ABM	1.0 ug DNA	EUR 154

SEC24A sgRNA CRISPR Lentivector (Human) (Target 2)
K2113503	ABM	1.0 ug DNA	EUR 154

SEC24A sgRNA CRISPR Lentivector (Human) (Target 3)
K2113504	ABM	1.0 ug DNA	EUR 154

Sec24a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4605502	ABM	1.0 ug DNA	EUR 154

Sec24a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4605503	ABM	1.0 ug DNA	EUR 154

Sec24a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4605504	ABM	1.0 ug DNA	EUR 154

Sec24a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6571502	ABM	1.0 ug DNA	EUR 154

Sec24a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6571503	ABM	1.0 ug DNA	EUR 154

Sec24a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6571504	ABM	1.0 ug DNA	EUR 154

SEC24A Protein Vector (Human) (pPB-C-His)
PV037205	ABM	500 ng	EUR 329

SEC24A Protein Vector (Human) (pPB-N-His)
PV037206	ABM	500 ng	EUR 329

SEC24A Protein Vector (Human) (pPM-C-HA)
PV037207	ABM	500 ng	EUR 329

SEC24A Protein Vector (Human) (pPM-C-His)
PV037208	ABM	500 ng	EUR 329

SEC24A Protein Vector (Rat) (pPB-C-His)
PV303862	ABM	500 ng	EUR 1191

SEC24A Protein Vector (Rat) (pPB-N-His)
PV303863	ABM	500 ng	EUR 1191

SEC24A Protein Vector (Rat) (pPM-C-HA)
PV303864	ABM	500 ng	EUR 1191

SEC24A Protein Vector (Rat) (pPM-C-His)
PV303865	ABM	500 ng	EUR 1191

SEC24A Protein Vector (Mouse) (pPB-C-His)
PV227426	ABM	500 ng	EUR 1065

SEC24A Protein Vector (Mouse) (pPB-N-His)
PV227427	ABM	500 ng	EUR 1065

SEC24A Protein Vector (Mouse) (pPM-C-HA)
PV227428	ABM	500 ng	EUR 1065

SEC24A Protein Vector (Mouse) (pPM-C-His)
PV227429	ABM	500 ng	EUR 1065

Sec24a 3'UTR GFP Stable Cell Line
TU168500	ABM	1.0 ml	Ask for price

SEC24A 3'UTR Luciferase Stable Cell Line
TU022838	ABM	1.0 ml	EUR 1521

Sec24a 3'UTR Luciferase Stable Cell Line
TU118500	ABM	1.0 ml	Ask for price

SEC24A 3'UTR GFP Stable Cell Line
TU072838	ABM	1.0 ml	EUR 1521

Sec24a 3'UTR Luciferase Stable Cell Line
TU220062	ABM	1.0 ml	Ask for price

Sec24a 3'UTR GFP Stable Cell Line
TU270062	ABM	1.0 ml	Ask for price

Human SEC24 Family Member A (SEC24A) ELISA Kit
abx383087-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SEC24 Homolog A, COPII Coat Complex Component (SEC24A) Antibody
abx237681-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2113505	ABM	3 x 1.0 ug	EUR 376

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4605505	ABM	3 x 1.0 ug	EUR 376

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6571505	ABM	3 x 1.0 ug	EUR 376

SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2113506	ABM	1.0 ug DNA	EUR 167

SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2113507	ABM	1.0 ug DNA	EUR 167

SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2113508	ABM	1.0 ug DNA	EUR 167

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4605506	ABM	1.0 ug DNA	EUR 167

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4605507	ABM	1.0 ug DNA	EUR 167

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4605508	ABM	1.0 ug DNA	EUR 167

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6571506	ABM	1.0 ug DNA	EUR 167

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6571507	ABM	1.0 ug DNA	EUR 167

Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6571508	ABM	1.0 ug DNA	EUR 167