SAMM50 antibody
70R-20079 50 ul
EUR 435
Description: Rabbit polyclonal SAMM50 antibody
SAMM50 Antibody
47197-100ul 100ul
EUR 252
SAMM50 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SAMM50. Recognizes SAMM50 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
SAMM50 Antibody
DF12729 200ul
EUR 304
Description: SAMM50 Antibody detects endogenous levels of SAMM50.
SAMM50 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SAMM50. Recognizes SAMM50 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SAMM50 Sorting And Assembly Machinery Component (Samm50) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
abx030839-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
abx030839-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
abx237593-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SAMM50 Sorting And Assembly Machinery Component (SAMM50) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SAMM50 cloning plasmid
CSB-CL896898HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggacta
  • Show more
Description: A cloning plasmid for the SAMM50 gene.
SAMM50 cloning plasmid
CSB-CL896898HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggacta
  • Show more
Description: A cloning plasmid for the SAMM50 gene.
SAMM50 cloning plasmid
CSB-CL896898HU3-10ug 10ug
EUR 503
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1407
  • Sequence: atggggactgtgcacgcccggagtttggagcctcttccatcaagtggacctgattttggaggattaggagaagaagctgaatttgttgaagttgagcctgaagctaaacaggaaattcttgaaaacaaagatgtggttgttcaacatgttcattttgatggacttggaaggacta
  • Show more
Description: A cloning plasmid for the SAMM50 gene.
SAMM50 Blocking Peptide
DF12729-BP 1mg
EUR 195
SAMM50 Conjugated Antibody
C47197 100ul
EUR 397
SAMM50 Rabbit pAb
A3401-100ul 100 ul
EUR 308
SAMM50 Rabbit pAb
A3401-200ul 200 ul
EUR 459
SAMM50 Rabbit pAb
A3401-20ul 20 ul
EUR 183
SAMM50 Rabbit pAb
A3401-50ul 50 ul
EUR 223
anti- SAMM50 antibody
FNab07593 100µg
EUR 548.75
  • Immunogen: sorting and assembly machinery component 50 homolog(S. cerevisiae)
  • Uniprot ID: Q9Y512
  • Gene ID: 25813
  • Research Area: Metabolism, Signal Transduction
Description: Antibody raised against SAMM50
Anti-SAMM50 antibody
PAab07593 100 ug
EUR 386
Anti-SAMM50 (2A9)
YF-MA18004 100 ug
EUR 363
Description: Mouse monoclonal to SAMM50
Anti-SAMM50 antibody
STJ25440 100 µl
EUR 277
Description: This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.
Human SAMM50 Sorting And Assembly Machinery Component (SAMM50) ELISA Kit
abx383019-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Polyclonal SAMM50 Antibody (Center)
AMR09809G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAMM50 (Center). This antibody is tested and proven to work in the following applications:
ELI-18886h 96 Tests
EUR 824
EF002708 96 Tests
EUR 689
ELI-45454b 96 Tests
EUR 928
Rat SAMM50 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SAMM50 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SAMM50 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Samm50 ELISA KIT
ELI-40818m 96 Tests
EUR 865
SAMM50 Recombinant Protein (Human)
RP027568 100 ug Ask for price
SAMM50 Recombinant Protein (Human)
RP027571 100 ug Ask for price
SAMM50 Recombinant Protein (Human)
RP027574 100 ug Ask for price
SAMM50 Recombinant Protein (Rat)
RP227453 100 ug Ask for price
SAMM50 Recombinant Protein (Mouse)
RP169967 100 ug Ask for price
Samm50 ORF Vector (Rat) (pORF)
ORF075819 1.0 ug DNA
EUR 506
SAMM50 ORF Vector (Human) (pORF)
ORF009190 1.0 ug DNA
EUR 95
SAMM50 ORF Vector (Human) (pORF)
ORF009191 1.0 ug DNA
EUR 95
SAMM50 ORF Vector (Human) (pORF)
ORF009192 1.0 ug DNA
EUR 95
Samm50 ORF Vector (Mouse) (pORF)
ORF056657 1.0 ug DNA
EUR 506
Polyclonal SAMM50 Antibody - N-terminal region
AMR09811G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SAMM50 - N-terminal region. This antibody is tested and proven to work in the following applications:
Samm50 sgRNA CRISPR Lentivector set (Rat)
K7443401 3 x 1.0 ug
EUR 339
Samm50 sgRNA CRISPR Lentivector set (Mouse)
K4593201 3 x 1.0 ug
EUR 339
SAMM50 sgRNA CRISPR Lentivector set (Human)
K2088101 3 x 1.0 ug
EUR 339
Monoclonal SAMM50 Antibody (monoclonal) (M04), Clone: 2A9
AMR09810G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SAMM50 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 2A9. This antibody is applicable in WB
Samm50 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7443402 1.0 ug DNA
EUR 154
Samm50 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7443403 1.0 ug DNA
EUR 154
Samm50 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7443404 1.0 ug DNA
EUR 154
Samm50 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4593202 1.0 ug DNA
EUR 154
Samm50 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4593203 1.0 ug DNA
EUR 154
Samm50 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4593204 1.0 ug DNA
EUR 154
SAMM50 sgRNA CRISPR Lentivector (Human) (Target 1)
K2088102 1.0 ug DNA
EUR 154
SAMM50 sgRNA CRISPR Lentivector (Human) (Target 2)
K2088103 1.0 ug DNA
EUR 154
SAMM50 sgRNA CRISPR Lentivector (Human) (Target 3)
K2088104 1.0 ug DNA
EUR 154
SAMM50 3'UTR Luciferase Stable Cell Line
TU022580 1.0 ml
EUR 1394
Samm50 3'UTR Luciferase Stable Cell Line
TU118337 1.0 ml Ask for price
Samm50 3'UTR GFP Stable Cell Line
TU168337 1.0 ml Ask for price
Samm50 3'UTR Luciferase Stable Cell Line
TU219909 1.0 ml Ask for price
Samm50 3'UTR GFP Stable Cell Line
TU269909 1.0 ml Ask for price
SAMM50 3'UTR GFP Stable Cell Line
TU072580 1.0 ml
EUR 1394
SAMM50 Protein Vector (Rat) (pPB-C-His)
PV303274 500 ng
EUR 603
SAMM50 Protein Vector (Rat) (pPB-N-His)
PV303275 500 ng
EUR 603
SAMM50 Protein Vector (Rat) (pPM-C-HA)
PV303276 500 ng
EUR 603
SAMM50 Protein Vector (Rat) (pPM-C-His)
PV303277 500 ng
EUR 603
SAMM50 Protein Vector (Mouse) (pPB-C-His)
PV226626 500 ng
EUR 603
SAMM50 Protein Vector (Mouse) (pPB-N-His)
PV226627 500 ng
EUR 603
SAMM50 Protein Vector (Mouse) (pPM-C-HA)
PV226628 500 ng
EUR 603
SAMM50 Protein Vector (Mouse) (pPM-C-His)
PV226629 500 ng
EUR 603
SAMM50 Protein Vector (Human) (pPB-C-His)
PV036757 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPB-N-His)
PV036758 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPM-C-HA)
PV036759 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPM-C-His)
PV036760 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPB-C-His)
PV036761 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPB-N-His)
PV036762 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPM-C-HA)
PV036763 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPM-C-His)
PV036764 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPB-C-His)
PV036765 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPB-N-His)
PV036766 500 ng
EUR 329
SAMM50 Protein Vector (Human) (pPM-C-HA)
PV036767 500 ng
EUR 329