NAPA antibody

20R-1339 100 ug
EUR 377
Description: Rabbit polyclonal NAPA antibody

NAPA Antibody

31126-100ul 100ul
EUR 252

NAPA Antibody

31126-50ul 50ul
EUR 187

NAPA antibody

70R-18750 50 ul
EUR 435
Description: Rabbit polyclonal NAPA antibody

NAPA antibody

10-N40A 500 ug
EUR 489
Description: Mouse monoclonal NAPA antibody

NAPA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

NAPA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NAPA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NAPA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAPA Blocking Peptide

33R-5853 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAPA antibody, catalog no. 20R-1339

NAPA Conjugated Antibody

C31126 100ul
EUR 397

NAPA cloning plasmid

CSB-CL015447HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggacaattccgggaaggaagcggaggcgatggcgctgttggccgaggcggagcgcaaagtgaagaactcgcagtccttcttctctggcctctttggaggctcatccaaaatagaggaagcatgcgaaatctacgccagagcagcaaacatgttcaaaatggccaaaaactggag
  • Show more
Description: A cloning plasmid for the NAPA gene.

NAPA Polyclonal Antibody

A59986 100 µg
EUR 570.55
Description: kits suitable for this type of research

NAPA Rabbit pAb

A7946-100ul 100 ul
EUR 308

NAPA Rabbit pAb

A7946-200ul 200 ul
EUR 459

NAPA Rabbit pAb

A7946-20ul 20 ul
EUR 183

NAPA Rabbit pAb

A7946-50ul 50 ul
EUR 223

Anti-NAPA antibody

STJ110255 100 µl
EUR 277
Description: This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene.

Anti-NAPA Antibody

STJ503074 100 µg
EUR 476

Borrelia NapA (80.0%) [His]

DAGA-467 5ug
EUR 502

NAPA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAPA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAPA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAPA. Recognizes NAPA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NAPA protein (His tag)

80R-1470 100 ug
EUR 305
Description: Purified recombinant Human NAPA protein

Rat NAPA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NAPA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NAPA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-NAPA Antibody (Biotin)

STJ503075 100 µg
EUR 586

Anti-NAPA Antibody (FITC)

STJ503076 100 µg
EUR 586


PVT16624 2 ug
EUR 325

NAPA Recombinant Protein (Human)

RP020665 100 ug Ask for price

NAPA Recombinant Protein (Mouse)

RP153074 100 ug Ask for price

NAPA Recombinant Protein (Rat)

RP213263 100 ug Ask for price

Human SNAP-alpha (NAPA) Antibody

30178-05111 150 ug
EUR 261

NAPA Polyclonal Antibody, Biotin Conjugated

A59987 100 µg
EUR 570.55
Description: fast delivery possible

NAPA Polyclonal Antibody, FITC Conjugated

A59988 100 µg
EUR 570.55
Description: reagents widely cited

NAPA Polyclonal Antibody, HRP Conjugated

A59989 100 µg
EUR 570.55
Description: Ask the seller for details

Napa ORF Vector (Rat) (pORF)

ORF071089 1.0 ug DNA
EUR 506

NAPA ORF Vector (Human) (pORF)

ORF006889 1.0 ug DNA
EUR 95

Napa ORF Vector (Mouse) (pORF)

ORF051026 1.0 ug DNA
EUR 506

Recombinant Aeromonas Hydrophila napA Protein

VAng-Lsx0847-inquire inquire Ask for price
Description: Aeromonas Hydrophila Periplasmic nitrate reductase, recombinant protein.

Recombinant Aeromonas Salmonicida napA Protein

VAng-Lsx1209-inquire inquire Ask for price
Description: Aeromonas Salmonicida Periplasmic nitrate reductase, recombinant protein.

Recombinant Borrelia Burgdorferi NapA Protein

VAng-Lsx1729-1mg 1 mg
EUR 9738
Description: Borrelia Burgdorferi NapA, recombinant protein from E. coli.

Recombinant Borrelia Burgdorferi NapA Protein

VAng-Lsx1729-20g 20 µg
EUR 612
Description: Borrelia Burgdorferi NapA, recombinant protein from E. coli.

Recombinant Borrelia Burgdorferi NapA Protein

VAng-Lsx1729-5g 5 µg
EUR 436
Description: Borrelia Burgdorferi NapA, recombinant protein from E. coli.

Napa sgRNA CRISPR Lentivector set (Rat)

K6956501 3 x 1.0 ug
EUR 339

Napa sgRNA CRISPR Lentivector set (Mouse)

K3558401 3 x 1.0 ug
EUR 339

NAPA sgRNA CRISPR Lentivector set (Human)

K1390401 3 x 1.0 ug
EUR 339

Human SNAP-alpha (NAPA) Antibody (Biotin Conjugate)

30178-05121 150 ug
EUR 369

Napa sgRNA CRISPR Lentivector (Rat) (Target 1)

K6956502 1.0 ug DNA
EUR 154

Napa sgRNA CRISPR Lentivector (Rat) (Target 2)

K6956503 1.0 ug DNA
EUR 154

Napa sgRNA CRISPR Lentivector (Rat) (Target 3)

K6956504 1.0 ug DNA
EUR 154

Napa sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3558402 1.0 ug DNA
EUR 154

Napa sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3558403 1.0 ug DNA
EUR 154

Napa sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3558404 1.0 ug DNA
EUR 154

NAPA sgRNA CRISPR Lentivector (Human) (Target 1)

K1390402 1.0 ug DNA
EUR 154

NAPA sgRNA CRISPR Lentivector (Human) (Target 2)

K1390403 1.0 ug DNA
EUR 154

NAPA sgRNA CRISPR Lentivector (Human) (Target 3)

K1390404 1.0 ug DNA
EUR 154

NAPA 3'UTR Luciferase Stable Cell Line

TU015224 1.0 ml
EUR 1394

Napa 3'UTR Luciferase Stable Cell Line

TU113835 1.0 ml Ask for price

Napa 3'UTR GFP Stable Cell Line

TU163835 1.0 ml Ask for price

Napa 3'UTR Luciferase Stable Cell Line

TU213741 1.0 ml Ask for price

Napa 3'UTR GFP Stable Cell Line

TU263741 1.0 ml Ask for price

NAPA 3'UTR GFP Stable Cell Line

TU065224 1.0 ml
EUR 1394

NAPA Protein Vector (Mouse) (pPB-C-His)

PV204102 500 ng
EUR 603

NAPA Protein Vector (Mouse) (pPB-N-His)

PV204103 500 ng
EUR 603

NAPA Protein Vector (Mouse) (pPM-C-HA)

PV204104 500 ng
EUR 603

NAPA Protein Vector (Mouse) (pPM-C-His)

PV204105 500 ng
EUR 603

NAPA Protein Vector (Rat) (pPB-C-His)

PV284354 500 ng
EUR 603

NAPA Protein Vector (Rat) (pPB-N-His)

PV284355 500 ng
EUR 603

NAPA Protein Vector (Rat) (pPM-C-HA)

PV284356 500 ng
EUR 603

NAPA Protein Vector (Rat) (pPM-C-His)

PV284357 500 ng
EUR 603

NAPA Protein Vector (Human) (pPB-C-His)

PV027553 500 ng
EUR 329

NAPA Protein Vector (Human) (pPB-N-His)

PV027554 500 ng
EUR 329

NAPA Protein Vector (Human) (pPM-C-HA)

PV027555 500 ng
EUR 329

NAPA Protein Vector (Human) (pPM-C-His)

PV027556 500 ng
EUR 329

Recombinant Human NAPA Protein, His, E.coli-1mg

QP12793-1mg 1mg
EUR 2757

Recombinant Human NAPA Protein, His, E.coli-20ug

QP12793-20ug 20ug
EUR 201

Recombinant Human NAPA Protein, His, E.coli-5ug

QP12793-5ug 5ug
EUR 155

Human SNAP-alpha (NAPA) AssayLite Antibody (FITC Conjugate)

30178-05141 150 ug
EUR 428

Human SNAP-alpha (NAPA) AssayLite Antibody (RPE Conjugate)

30178-05151 150 ug
EUR 428

Human SNAP-alpha (NAPA) AssayLite Antibody (APC Conjugate)

30178-05161 150 ug
EUR 428

Human SNAP-alpha (NAPA) AssayLite Antibody (PerCP Conjugate)

30178-05171 150 ug
EUR 471

NAPA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690067 1.0 ug DNA
EUR 514

NAPA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690071 1.0 ug DNA
EUR 514

NAPA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690072 1.0 ug DNA
EUR 514

Recombinant Shigella Dysenteriae napA Protein (aa 1-828)

VAng-Lsx07015-inquire inquire Ask for price
Description: Shigella Dysenteriae serotype 1 (strain Sd197) Periplasmic nitrate reductase, recombinant protein.

Recombinant Shigella Boydii napA Protein (aa 1-828)

VAng-Lsx08726-inquire inquire Ask for price
Description: Shigella Boydii serotype 4 (strain Sb227) Periplasmic nitrate reductase, recombinant protein.

Recombinant Haemophilus Influenzae napA Protein (aa 1-827)

VAng-Lsx03531-inquire inquire Ask for price
Description: Haemophilus Influenzae (strain PittEE) Periplasmic nitrate reductase, recombinant protein.

Recombinant Pseudomonas Aeruginosa napA Protein (aa 1-834)

VAng-Cr0060-inquire inquire Ask for price
Description: Pseudomonas Aeruginosa periplasmic nitrate reductase (napA), recombinant protein.

Recombinant Shigella Flexneri napA Protein (aa 1-828)

VAng-Lsx07975-inquire inquire Ask for price
Description: Shigella Flexneri Periplasmic nitrate reductase, recombinant protein.

Recombinant Shigella Sonnei napA Protein (aa 1-828)

VAng-Lsx09939-inquire inquire Ask for price
Description: Shigella Sonnei (strain Ss046) Periplasmic nitrate reductase, recombinant protein.