Bovine Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-b-96T 96T
EUR 715
  • Should the Bovine Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-Hu-48T 48T
EUR 479
  • Should the Human Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-Hu-96T 96T
EUR 621
  • Should the Human Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-Mu-48T 48T
EUR 489
  • Should the Mouse Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-Mu-96T 96T
EUR 635
  • Should the Mouse Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-Ra-48T 48T
EUR 508
  • Should the Rat Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Inhibin Beta E (INHbE) ELISA Kit

DLR-INHbE-Ra-96T 96T
EUR 661
  • Should the Rat Inhibin Beta E (INHbE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Inhibin Beta E (INHbE) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-b-48Tests 48 Tests
EUR 580

Bovine Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-b-96Tests 96 Tests
EUR 807

Human Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-Hu-48Tests 48 Tests
EUR 500

Human Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-Hu-96Tests 96 Tests
EUR 692

Mouse Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-Mu-48Tests 48 Tests
EUR 511

Mouse Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-Mu-96Tests 96 Tests
EUR 709

Rat Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-Ra-48Tests 48 Tests
EUR 534

Rat Inhibin Beta E (INHbE) ELISA Kit

RDR-INHbE-Ra-96Tests 96 Tests
EUR 742

Bovine Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-b-48Tests 48 Tests
EUR 555

Bovine Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-b-96Tests 96 Tests
EUR 771

Human Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-Hu-48Tests 48 Tests
EUR 478

Human Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-Hu-96Tests 96 Tests
EUR 662

Mouse Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-Mu-48Tests 48 Tests
EUR 489

Mouse Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-Mu-96Tests 96 Tests
EUR 677

Rat Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-Ra-48Tests 48 Tests
EUR 511

Rat Inhibin Beta E (INHbE) ELISA Kit

RD-INHbE-Ra-96Tests 96 Tests
EUR 709

Inhbe/ Rat Inhbe ELISA Kit

ELI-43732r 96 Tests
EUR 886

INHBE Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against INHBE. Recognizes INHBE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21248 50 ul
EUR 363
Description: Mouse polyclonal to INHBE


YF-PA21249 50 ug
EUR 363
Description: Mouse polyclonal to INHBE


YF-PA21250 50 ug
EUR 363
Description: Mouse polyclonal to INHBE


YF-PA21251 100 ul
EUR 403
Description: Rabbit polyclonal to INHBE


YF-PA21252 100 ug
EUR 403
Description: Rabbit polyclonal to INHBE

INHBE cloning plasmid

CSB-CL011722HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Sequence: atgcggctccctgatgtccagctctggctggtgctgctgtgggcactggtgcgagcacaggggacagggtctgtgtgtccctcctgtgggggctccaaactggcaccccaagcagaacgagctctggtgctggagctagccaagcagcaaatcctggatgggttgcacctgacca
  • Show more
Description: A cloning plasmid for the INHBE gene.

Anti-INHBE (4B5)

YF-MA19478 100 ug
EUR 363
Description: Mouse monoclonal to INHBE

Rat INHBE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human INHBE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse INHBE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

INHBE Recombinant Protein (Human)

RP016168 100 ug Ask for price

INHBE Recombinant Protein (Rat)

RP206045 100 ug Ask for price

INHBE Recombinant Protein (Mouse)

RP143852 100 ug Ask for price

Inhibin Beta E (INHbE) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Inhibin Beta E (INHbE) Antibody

  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Inhibin Beta E (INHbE) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Inhibin Beta E (INHbE) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Inhibin Beta E (INHbE) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Inhibin Beta E (INHBE) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Inhibin Beta E (INHbE) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Inhibin Beta E (INHbE) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Inhibin Beta E (INHBE) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Inhbe ORF Vector (Rat) (pORF)

ORF068683 1.0 ug DNA
EUR 506

INHBE ORF Vector (Human) (pORF)

ORF005390 1.0 ug DNA
EUR 95

Inhbe ORF Vector (Mouse) (pORF)

ORF047952 1.0 ug DNA
EUR 506

INHBE ELISA Kit (Bovine) (OKCD04413)

OKCD04413 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Cattle;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.3 pg/mL

INHBE ELISA Kit (Human) (OKCD00128)

OKCD00128 96 Wells
EUR 792
Description: Description of target: Inhibins and activins inhibit and activate, respectively, the secretion of follitropin by the pituitary gland. Inhibins/activins are involved in regulating a number of diverse functions such as hypothalamic and pituitary hormone secretion, gonadal hormone secretion, germ cell development and maturation, erythroid differentiation, insulin secretion, nerve cell survival, embryonic axial development or bone growth, depending on their subunit composition. Inhibins appear to oppose the functions of activins. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.7 pg/mL

Recombinant Inhibin Beta E (INHbE)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P58166
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.7kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Inhibin Beta E expressed in: E.coli

Recombinant Inhibin Beta E (INHbE)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O08717
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.6kDa
  • Isoelectric Point: 8.1
Description: Recombinant Mouse Inhibin Beta E expressed in: E.coli

Recombinant Inhibin Beta E (INHbE)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88959
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.0kDa
  • Isoelectric Point: 6
Description: Recombinant Rat Inhibin Beta E expressed in: E.coli

Mouse Inhibin Beta E (INHbE) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Inhibin Beta E (INHbE) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.