GNAI3

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit
DLR-GNaI3-Hu-96T	DL Develop	96T	EUR 673
Should the Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit
RDR-GNaI3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit
RDR-GNaI3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit
RD-GNaI3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human G Protein Alpha Inhibiting Activity Polypeptide 3 (GNaI3) ELISA Kit
RD-GNaI3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Gnai3/ Rat Gnai3 ELISA Kit
ELI-38026r	Lifescience Market	96 Tests	EUR 886

GNAI3 antibody
70R-17521	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GNAI3 antibody

GNAI3 Antibody
36493-100ul	SAB	100ul	EUR 252

GNAI3 Antibody
1-CSB-PA120564	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GNAI3 Antibody
DF4107	Affbiotech	200ul	EUR 304
Description: GNAI3 Antibody detects endogenous levels of total GNAI3.

GNAI3 Antibody
1-CSB-PA576871	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

GNAI3 antibody
70R-35506	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal GNAI3 antibody

GNAI3 antibody
70R-9626	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GNAI3 antibody

GNAI3 antibody
70R-9627	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal GNAI3 antibody

GNAI3 Antibody
1-CSB-PA008887	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

GNAI3 Antibody
1-CSB-PA009591GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GNAI3 Antibody
1-CSB-PA009591LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

GNAI3 siRNA
20-abx902214	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAI3 Protein
20-abx262510	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

GNAI3 siRNA
20-abx918146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAI3 siRNA
20-abx918147	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNAI3 Antibody
ABD4107	Lifescience Market	100 ug	EUR 438

anti-GNAI3
YF-PA12056	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GNAI3

GNAI3 Rabbit pAb
A15674-100ul	Abclonal	100 ul	EUR 308

GNAI3 Rabbit pAb
A15674-200ul	Abclonal	200 ul	EUR 459

GNAI3 Rabbit pAb
A15674-20ul	Abclonal	20 ul	EUR 183

GNAI3 Rabbit pAb
A15674-50ul	Abclonal	50 ul	EUR 223

GNAI3 Blocking Peptide
33R-2729	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI3 antibody, catalog no. 70R-9626

GNAI3 Blocking Peptide
33R-9315	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI3 antibody, catalog no. 70R-9627

GNAI3 Blocking Peptide
DF4107-BP	Affbiotech	1mg	EUR 195

GNAI3 Conjugated Antibody
C36493	SAB	100ul	EUR 397

GNAI3 cloning plasmid
CSB-CL009591HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1065 Sequence: atgggctgcacgttgagcgccgaagacaaggcggcagtggagcgaagcaagatgatcgaccgcaacttacgggaggacggggaaaaagcggccaaagaagtgaagctgctgctactcggtgctggagaatctggtaaaagcaccattgtgaaacagatgaaaatcattcatgagg Show more
Description: A cloning plasmid for the GNAI3 gene.

GNAI3 Polyclonal Antibody
A62666	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GNAI3 Rabbit pAb
A1922-100ul	Abclonal	100 ul	EUR 308

GNAI3 Rabbit pAb
A1922-200ul	Abclonal	200 ul	EUR 459

GNAI3 Rabbit pAb
A1922-20ul	Abclonal	20 ul	EUR 183

GNAI3 Rabbit pAb
A1922-50ul	Abclonal	50 ul	EUR 223

anti- GNAI3 antibody
FNab03533	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000 - 1:2000 IHC: 1:50 - 1:100 Immunogen: guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 Uniprot ID: P08754 Gene ID: 2773 Research Area: Signal Transduction
Description: Antibody raised against GNAI3

Anti-GNAI3 antibody
PAab03533	Lifescience Market	100 ug	EUR 355

Anti-GNAI3 antibody
STJ115271	St John's Laboratory	100 µl	EUR 413
Description: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway.

Anti-GNAI3 antibody
STJ118134	St John's Laboratory	100 µl	EUR 277

Anti-GNAI3 antibody
STJ29871	St John's Laboratory	100 µl	EUR 277
Description: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway.

GNAI3 protein (His tag)
80R-2227	Fitzgerald	50 ug	EUR 322
Description: Purified recombinant Human GNAI3 Protein (His tag)

Mouse Gnai3 ELISA KIT
ELI-27930m	Lifescience Market	96 Tests	EUR 865

GNAI3 ELISA KIT|Human
EF009908	Lifescience Market	96 Tests	EUR 689

Rat GNAI3 shRNA Plasmid
20-abx985188	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNAI3 Polyclonal Conjugated Antibody
C27977	SAB	100ul	EUR 397

GNAI3 Antibody, HRP conjugated
1-CSB-PA009591LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNAI3 Antibody, FITC conjugated
1-CSB-PA009591LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNAI3 Antibody, Biotin conjugated
1-CSB-PA009591LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNAI3. Recognizes GNAI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNAI3 shRNA Plasmid
20-abx951843	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNAI3 shRNA Plasmid
20-abx970576	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNAI3 ELISA KIT
ELI-32692h	Lifescience Market	96 Tests	EUR 824

GNAI3 Recombinant Protein (Human)
RP013474	ABM	100 ug	Ask for price

GNAI3 Recombinant Protein (Rat)
RP202949	ABM	100 ug	Ask for price

GNAI3 Recombinant Protein (Mouse)
RP138902	ABM	100 ug	Ask for price

[KO Validated] GNAI3 Polyclonal Antibody
27977-100ul	SAB	100ul	EUR 252

[KO Validated] GNAI3 Polyclonal Antibody
27977-50ul	SAB	50ul	EUR 187

[KO Validated] GNAI3 Rabbit pAb
A13307-100ul	Abclonal	100 ul	EUR 410

[KO Validated] GNAI3 Rabbit pAb
A13307-200ul	Abclonal	200 ul	EUR 571