EXOSC4 antibody

70R-1330 100 ug
EUR 377
Description: Rabbit polyclonal EXOSC4 antibody raised against the N terminal of EXOSC4

EXOSC4 antibody

31991-100ul 100ul
EUR 252

EXOSC4 antibody

31991-50ul 50ul
EUR 187

EXOSC4 Antibody

DF12991 200ul
EUR 304
Description: EXOSC4 Antibody detects endogenous levels of EXOSC4.

EXOSC4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EXOSC4. Recognizes EXOSC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA26258 50 ul
EUR 334
Description: Mouse polyclonal to EXOSC4

EXOSC4 Blocking Peptide

33R-8366 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOSC4 antibody, catalog no. 70R-1330

EXOSC4 Polyclonal Antibody

31675-100ul 100ul
EUR 252

EXOSC4 Polyclonal Antibody

31675-50ul 50ul
EUR 187

EXOSC4 Blocking Peptide

DF12991-BP 1mg
EUR 195

EXOSC4 cloning plasmid

CSB-CL889069HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 738
  • Sequence: atggcggggctggagctcttgtcggaccagggctaccgggtggacgggcggcgcgccggggagctgcgcaagatccaggcgcggatgggcgtgttcgcgcaggctgacggctcggcctacattgagcagggcaacaccaaggcactggctgtggtctacggcccgcacgagatccg
  • Show more
Description: A cloning plasmid for the EXOSC4 gene.

EXOSC4 Rabbit pAb

A9147-100ul 100 ul
EUR 308

EXOSC4 Rabbit pAb

A9147-200ul 200 ul
EUR 459

EXOSC4 Rabbit pAb

A9147-20ul 20 ul
EUR 183

EXOSC4 Rabbit pAb

A9147-50ul 50 ul
EUR 223

anti- EXOSC4 antibody

FNab02904 100µg
EUR 505.25
  • Immunogen: exosome component 4
  • Uniprot ID: Q9NPD3
  • Gene ID: 54512
  • Research Area: Immunology, Metabolism
Description: Antibody raised against EXOSC4

Anti-EXOSC4 antibody

PAab02904 100 ug
EUR 355

Anti-EXOSC4 (4F10)

YF-MA18652 100 ug
EUR 363
Description: Mouse monoclonal to EXOSC4

Anti-EXOSC4 (4F9)

YF-MA18653 100 ug
EUR 363
Description: Mouse monoclonal to EXOSC4

Anti-EXOSC4 antibody

STJ113618 100 µl
EUR 277

EXOSC4 protein (His tag)

80R-3548 100 ug
EUR 424
Description: Purified recombinant EXOSC4 protein (His tag)


EF009481 96 Tests
EUR 689

EXOSC4 Polyclonal Conjugated Antibody

C31675 100ul
EUR 397

EXOSC4 Polyclonal Conjugated Antibody

C31991 100ul
EUR 397

Human EXOSC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EXOSC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOSC4 Recombinant Protein (Human)

RP011071 100 ug Ask for price

EXOSC4 Recombinant Protein (Rat)

RP200117 100 ug Ask for price

EXOSC4 Recombinant Protein (Mouse)

RP132518 100 ug Ask for price

Exosome Component 4 (EXOSC4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exosome Component 4 (EXOSC4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exosome Component 4 (EXOSC4) Antibody

abx029390-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Exosome Component 4 (EXOSC4) Antibody

abx029390-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Exosome Component 4 (EXOSC4) Antibody

abx232904-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Exosc4 ORF Vector (Rat) (pORF)

ORF066707 1.0 ug DNA
EUR 506

EXOSC4 ORF Vector (Human) (pORF)

ORF003691 1.0 ug DNA
EUR 95

Exosc4 ORF Vector (Mouse) (pORF)

ORF044174 1.0 ug DNA
EUR 506

Exosc4 sgRNA CRISPR Lentivector set (Mouse)

K4862501 3 x 1.0 ug
EUR 339

EXOSC4 sgRNA CRISPR Lentivector set (Human)

K0703801 3 x 1.0 ug
EUR 339

Exosc4 sgRNA CRISPR Lentivector set (Rat)

K6168001 3 x 1.0 ug
EUR 339

Human Exosome Component 4 (EXOSC4)ELISA Kit

201-12-2691 96 tests
EUR 440
  • This Exosome Component 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Exosome Component 4 (EXOSC4) ELISA Kit

abx387223-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Exosc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4862502 1.0 ug DNA
EUR 154

Exosc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4862503 1.0 ug DNA
EUR 154

Exosc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4862504 1.0 ug DNA
EUR 154

EXOSC4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0703802 1.0 ug DNA
EUR 154

EXOSC4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0703803 1.0 ug DNA
EUR 154

EXOSC4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0703804 1.0 ug DNA
EUR 154

Exosc4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6168002 1.0 ug DNA
EUR 154

Exosc4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6168003 1.0 ug DNA
EUR 154

Exosc4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6168004 1.0 ug DNA
EUR 154

EXOSC4 3'UTR Luciferase Stable Cell Line

TU007134 1.0 ml
EUR 1394

Exosc4 3'UTR GFP Stable Cell Line

TU156020 1.0 ml Ask for price

Exosc4 3'UTR Luciferase Stable Cell Line

TU106020 1.0 ml Ask for price

Exosc4 3'UTR Luciferase Stable Cell Line

TU204160 1.0 ml Ask for price

Exosc4 3'UTR GFP Stable Cell Line

TU254160 1.0 ml Ask for price

EXOSC4 3'UTR GFP Stable Cell Line

TU057134 1.0 ml
EUR 1394

EXOSC4 Protein Vector (Mouse) (pPB-C-His)

PV176694 500 ng
EUR 603

EXOSC4 Protein Vector (Mouse) (pPB-N-His)

PV176695 500 ng
EUR 603

EXOSC4 Protein Vector (Mouse) (pPM-C-HA)

PV176696 500 ng
EUR 603

EXOSC4 Protein Vector (Mouse) (pPM-C-His)

PV176697 500 ng
EUR 603

EXOSC4 Protein Vector (Rat) (pPB-C-His)

PV266826 500 ng
EUR 603

EXOSC4 Protein Vector (Rat) (pPB-N-His)

PV266827 500 ng
EUR 603

EXOSC4 Protein Vector (Rat) (pPM-C-HA)

PV266828 500 ng
EUR 603

EXOSC4 Protein Vector (Rat) (pPM-C-His)

PV266829 500 ng
EUR 603

EXOSC4 Protein Vector (Human) (pPB-C-His)

PV014761 500 ng
EUR 329

EXOSC4 Protein Vector (Human) (pPB-N-His)

PV014762 500 ng
EUR 329

EXOSC4 Protein Vector (Human) (pPM-C-HA)

PV014763 500 ng
EUR 329