EXOC2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC2. Recognizes EXOC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EXOC2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC2. Recognizes EXOC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXOC2 Polyclonal Antibody

31481-100ul 100ul
EUR 252

EXOC2 Polyclonal Antibody

31481-50ul 50ul
EUR 187

SEC5/EXOC2 Antibody

DF12043 200ul
EUR 304
Description: SEC5/EXOC2 antibody detects endogenous levels of SEC5/EXOC2.

EXOC2 cloning plasmid

CSB-CL007878HU-10ug 10ug
EUR 887
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2775
  • Sequence: atgtctcgatcacgacaacccccccttgtgaccggcatctctccaaatgaagggataccatggacgaaggtcacaatcaggggagaaaatctggggactggccccaccgacctcataggcttgaccatttgtggacataattgcctcctgacggcagaatggatgtctgcaagta
  • Show more
Description: A cloning plasmid for the EXOC2 gene.

EXOC2 Rabbit pAb

A8235-100ul 100 ul
EUR 308

EXOC2 Rabbit pAb

A8235-200ul 200 ul
EUR 459

EXOC2 Rabbit pAb

A8235-20ul 20 ul
EUR 183

EXOC2 Rabbit pAb

A8235-50ul 50 ul
EUR 223

Anti-EXOC2 antibody

STJ110534 100 µl
EUR 277
Description: The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants.

Anti-EXOC2 antibody

STJ11100824 100 µl
EUR 413
Description: The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants.

SEC5/EXOC2 Blocking Peptide

DF12043-BP 1mg
EUR 195

Rat EXOC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EXOC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EXOC2 Polyclonal Conjugated Antibody

C31481 100ul
EUR 397

Human EXOC2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti- SEC5/EXOC2 antibody

FNab07684 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: exocyst complex component 2
  • Uniprot ID: Q96KP1
  • Research Area: Signal Transduction
Description: Antibody raised against SEC5/EXOC2

anti- SEC5/EXOC2 antibody

FNab07685 100µg
EUR 585
  • Recommended dilution: WB: 1:2500-1:10000
  • IP: 1:500-1:1000
  • IHC: 1:200-1:800
  • IF: 1:10-1:100
  • Immunogen: exocyst complex component 2
  • Uniprot ID: Q96KP1
  • Research Area: Signal Transduction
Description: Antibody raised against SEC5/EXOC2

Anti-SEC5/EXOC2 antibody

PAab07684 100 ug
EUR 355


EF002793 96 Tests
EUR 689

[KO Validated] EXOC2 Rabbit pAb

A19948-100ul 100 ul
EUR 410

[KO Validated] EXOC2 Rabbit pAb

A19948-200ul 200 ul
EUR 571

[KO Validated] EXOC2 Rabbit pAb

A19948-20ul 20 ul
EUR 221

[KO Validated] EXOC2 Rabbit pAb

A19948-50ul 50 ul
EUR 287

Exoc2 ORF Vector (Rat) (pORF)

ORF066694 1.0 ug DNA
EUR 506

EXOC2 ORF Vector (Human) (pORF)

ORF003680 1.0 ug DNA
EUR 95

Exoc2 ORF Vector (Mouse) (pORF)

ORF044157 1.0 ug DNA
EUR 506

Exocyst Complex Component 2 (EXOC2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody

abx037078-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exocyst Complex Component 2 (EXOC2) Antibody

abx237684-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Exocyst Complex Component 2 (EXOC2) Antibody

abx237685-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Exocyst Complex Component 2 (EXOC2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exoc2 sgRNA CRISPR Lentivector set (Mouse)

K5012601 3 x 1.0 ug
EUR 339

EXOC2 sgRNA CRISPR Lentivector set (Human)

K0702201 3 x 1.0 ug
EUR 339

Exoc2 sgRNA CRISPR Lentivector set (Rat)

K7058501 3 x 1.0 ug
EUR 339

Exoc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5012602 1.0 ug DNA
EUR 154

Exoc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5012603 1.0 ug DNA
EUR 154

Exoc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5012604 1.0 ug DNA
EUR 154

EXOC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0702202 1.0 ug DNA
EUR 154

EXOC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0702203 1.0 ug DNA
EUR 154

EXOC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0702204 1.0 ug DNA
EUR 154

Exoc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7058502 1.0 ug DNA
EUR 154

Exoc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7058503 1.0 ug DNA
EUR 154

Exoc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7058504 1.0 ug DNA
EUR 154

EXOC2 3'UTR Luciferase Stable Cell Line

TU007118 1.0 ml
EUR 1521

Exoc2 3'UTR GFP Stable Cell Line

TU156005 1.0 ml Ask for price

Exoc2 3'UTR Luciferase Stable Cell Line

TU106005 1.0 ml Ask for price

Exoc2 3'UTR Luciferase Stable Cell Line

TU204147 1.0 ml Ask for price

Exoc2 3'UTR GFP Stable Cell Line

TU254147 1.0 ml Ask for price

EXOC2 3'UTR GFP Stable Cell Line

TU057118 1.0 ml
EUR 1521

EXOC2 Protein Vector (Mouse) (pPB-C-His)

PV176626 500 ng
EUR 1065

EXOC2 Protein Vector (Mouse) (pPB-N-His)

PV176627 500 ng
EUR 1065

EXOC2 Protein Vector (Mouse) (pPM-C-HA)

PV176628 500 ng
EUR 1065

EXOC2 Protein Vector (Mouse) (pPM-C-His)

PV176629 500 ng
EUR 1065

EXOC2 Protein Vector (Rat) (pPB-C-His)

PV266774 500 ng
EUR 1191

EXOC2 Protein Vector (Rat) (pPB-N-His)

PV266775 500 ng
EUR 1191

EXOC2 Protein Vector (Rat) (pPM-C-HA)

PV266776 500 ng
EUR 1191

EXOC2 Protein Vector (Rat) (pPM-C-His)

PV266777 500 ng
EUR 1191

EXOC2 Protein Vector (Human) (pPB-C-His)

PV014717 500 ng
EUR 329

EXOC2 Protein Vector (Human) (pPB-N-His)

PV014718 500 ng
EUR 329

EXOC2 Protein Vector (Human) (pPM-C-HA)

PV014719 500 ng
EUR 329

EXOC2 Protein Vector (Human) (pPM-C-His)

PV014720 500 ng
EUR 329

Human Exocyst Complex Component 2 (EXOC2) ELISA Kit

abx259834-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Exocyst complex component 2, Exoc2 ELISA KIT

ELI-20565m 96 Tests
EUR 865

Human Exocyst complex component 2, EXOC2 ELISA KIT

ELI-27371h 96 Tests
EUR 824