EDEM3

EDEM3 siRNA
20-abx914952	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDEM3 siRNA
20-abx914953	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EDEM3 Antibody
45972-100ul	SAB	100ul	EUR 252

EDEM3 Antibody
45972-50ul	SAB	50ul	EUR 187

EDEM3 Antibody
DF9504	Affbiotech	200ul	EUR 304
Description: EDEM3 Antibody detects endogenous levels of total EDEM3.

Polyclonal EDEM3 Antibody
AMM07005G	Leading Biology	0.1mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM3 . This antibody is tested and proven to work in the following applications:

EDEM3 Conjugated Antibody
C45972	SAB	100ul	EUR 397

EDEM3 Polyclonal Antibody
ES9649-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Polyclonal Antibody
ES9649-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Polyclonal Antibody
ABP58454-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody
ABP58454-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody
ABP58454-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Blocking Peptide
3614BP-50	Biovision		EUR 153

EDEM3 cloning plasmid
CSB-CL863170HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 369 Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca Show more
Description: A cloning plasmid for the EDEM3 gene.

EDEM3 Blocking Peptide
DF9504-BP	Affbiotech	1mg	EUR 195

Anti-EDEM3 antibody
STJ190807	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EDEM3

Mouse EDEM3 shRNA Plasmid
20-abx975889	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EDEM3 shRNA Plasmid
20-abx962830	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Edem3 ELISA KIT
ELI-26645m	Lifescience Market	96 Tests	EUR 865

Human EDEM3 ELISA KIT
ELI-47172h	Lifescience Market	96 Tests	EUR 824

EDEM3 ORF Vector (Human) (pORF)
ORF003388	ABM	1.0 ug DNA	EUR 95

Edem3 ORF Vector (Rat) (pORF)
ORF066352	ABM	1.0 ug DNA	EUR 506

Edem3 ORF Vector (Mouse) (pORF)
ORF043621	ABM	1.0 ug DNA	EUR 506

EDEM3 sgRNA CRISPR Lentivector set (Human)
K0653601	ABM	3 x 1.0 ug	EUR 339

Edem3 sgRNA CRISPR Lentivector set (Mouse)
K3468201	ABM	3 x 1.0 ug	EUR 339

Edem3 sgRNA CRISPR Lentivector set (Rat)
K6190401	ABM	3 x 1.0 ug	EUR 339

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0653602	ABM	1.0 ug DNA	EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0653603	ABM	1.0 ug DNA	EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0653604	ABM	1.0 ug DNA	EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3468202	ABM	1.0 ug DNA	EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3468203	ABM	1.0 ug DNA	EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3468204	ABM	1.0 ug DNA	EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6190402	ABM	1.0 ug DNA	EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6190403	ABM	1.0 ug DNA	EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6190404	ABM	1.0 ug DNA	EUR 154

EDEM3 Protein Vector (Mouse) (pPB-C-His)
PV174482	ABM	500 ng	EUR 1065

EDEM3 Protein Vector (Mouse) (pPB-N-His)
PV174483	ABM	500 ng	EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-HA)
PV174484	ABM	500 ng	EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-His)
PV174485	ABM	500 ng	EUR 1065

EDEM3 Protein Vector (Human) (pPB-C-His)
PV013549	ABM	500 ng	EUR 329

EDEM3 Protein Vector (Human) (pPB-N-His)
PV013550	ABM	500 ng	EUR 329

EDEM3 Protein Vector (Human) (pPM-C-HA)
PV013551	ABM	500 ng	EUR 329

EDEM3 Protein Vector (Human) (pPM-C-His)
PV013552	ABM	500 ng	EUR 329

EDEM3 Protein Vector (Rat) (pPB-C-His)
PV265406	ABM	500 ng	EUR 1166

EDEM3 Protein Vector (Rat) (pPB-N-His)
PV265407	ABM	500 ng	EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-HA)
PV265408	ABM	500 ng	EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-His)
PV265409	ABM	500 ng	EUR 1166

Edem3 3'UTR Luciferase Stable Cell Line
TU203778	ABM	1.0 ml	Ask for price

Edem3 3'UTR GFP Stable Cell Line
TU155599	ABM	1.0 ml	Ask for price

EDEM3 3'UTR Luciferase Stable Cell Line
TU006561	ABM	1.0 ml	EUR 2333

Edem3 3'UTR Luciferase Stable Cell Line
TU105599	ABM	1.0 ml	Ask for price

EDEM3 3'UTR GFP Stable Cell Line
TU056561	ABM	1.0 ml	EUR 2333

Edem3 3'UTR GFP Stable Cell Line
TU253778	ABM	1.0 ml	Ask for price

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0653605	ABM	3 x 1.0 ug	EUR 376

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody
abx028901-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody
abx028901-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody
20-abx215068	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3468205	ABM	3 x 1.0 ug	EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6190405	ABM	3 x 1.0 ug	EUR 376

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0653606	ABM	1.0 ug DNA	EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0653607	ABM	1.0 ug DNA	EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0653608	ABM	1.0 ug DNA	EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3468206	ABM	1.0 ug DNA	EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3468207	ABM	1.0 ug DNA	EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3468208	ABM	1.0 ug DNA	EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6190406	ABM	1.0 ug DNA	EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6190407	ABM	1.0 ug DNA	EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6190408	ABM	1.0 ug DNA	EUR 167