EDEM3 Antibody

45972-50ul 50ul
EUR 187

EDEM3 Antibody

DF9504 200ul
EUR 304
Description: EDEM3 Antibody detects endogenous levels of total EDEM3.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 Antibody

ABD9504 100 ug
EUR 438

EDEM3 Blocking Peptide

EUR 153

EDEM3 Blocking Peptide

DF9504-BP 1mg
EUR 195

EDEM3 Polyclonal Antibody

ABP58454-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

EDEM3 Polyclonal Antibody

ABP58454-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDEM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDEM3 from Human, Mouse. This EDEM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDEM3 protein

Polyclonal EDEM3 Antibody

AMM07005G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM3 . This antibody is tested and proven to work in the following applications:

EDEM3 Conjugated Antibody

C45972 100ul
EUR 397

EDEM3 cloning plasmid

CSB-CL863170HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
  • Show more
Description: A cloning plasmid for the EDEM3 gene.

EDEM3 Polyclonal Antibody

ES9649-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Polyclonal Antibody

ES9649-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-EDEM3 antibody

STJ190807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDEM3

Mouse Edem3 ELISA KIT

ELI-26645m 96 Tests
EUR 865

Mouse EDEM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDEM3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-47172h 96 Tests
EUR 824

Edem3 ORF Vector (Rat) (pORF)

ORF066352 1.0 ug DNA
EUR 506

EDEM3 ORF Vector (Human) (pORF)

ORF003388 1.0 ug DNA
EUR 95

Edem3 ORF Vector (Mouse) (pORF)

ORF043621 1.0 ug DNA
EUR 506

EDEM3 sgRNA CRISPR Lentivector set (Human)

K0653601 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Rat)

K6190401 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Mouse)

K3468201 3 x 1.0 ug
EUR 339

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653602 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653603 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653604 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6190402 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6190403 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6190404 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3468202 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3468203 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3468204 1.0 ug DNA
EUR 154

EDEM3 3'UTR Luciferase Stable Cell Line

TU006561 1.0 ml
EUR 2333

Edem3 3'UTR GFP Stable Cell Line

TU155599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU105599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU203778 1.0 ml Ask for price

Edem3 3'UTR GFP Stable Cell Line

TU253778 1.0 ml Ask for price

EDEM3 3'UTR GFP Stable Cell Line

TU056561 1.0 ml
EUR 2333

EDEM3 Protein Vector (Mouse) (pPB-C-His)

PV174482 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPB-N-His)

PV174483 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-HA)

PV174484 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-His)

PV174485 500 ng
EUR 1065

EDEM3 Protein Vector (Rat) (pPB-C-His)

PV265406 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPB-N-His)

PV265407 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-HA)

PV265408 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-His)

PV265409 500 ng
EUR 1166

EDEM3 Protein Vector (Human) (pPB-C-His)

PV013549 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPB-N-His)

PV013550 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-HA)

PV013551 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-His)

PV013552 500 ng
EUR 329

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0653605 3 x 1.0 ug
EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6190405 3 x 1.0 ug
EUR 376

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3468205 3 x 1.0 ug
EUR 376

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0653606 1.0 ug DNA
EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0653607 1.0 ug DNA
EUR 167

EDEM3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0653608 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6190406 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6190407 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6190408 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3468206 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3468207 1.0 ug DNA
EUR 167

Edem3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3468208 1.0 ug DNA
EUR 167