DYNC1LI1

DYNC1LI1 siRNA
20-abx901611	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYNC1LI1 siRNA
20-abx914803	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYNC1LI1 siRNA
20-abx914804	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DYNC1LI1 Antibody
47086-100ul	SAB	100ul	EUR 252

DYNC1LI1 antibody
10R-3925	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody
10R-3926	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody
10R-3927	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody
10R-3929	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 antibody
10R-3930	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal DYNC1LI1 antibody

DYNC1LI1 Antibody
1-CSB-PA897312LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

DYNC1LI1 Conjugated Antibody
C47086	SAB	100ul	EUR 397

anti- DYNC1LI1 antibody
FNab02585	FN Test	100µg	EUR 585
Immunogen: dynein, cytoplasmic 1, light intermediate chain 1 Uniprot ID: Q9Y6G9 Gene ID: 51143 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against DYNC1LI1

DYNC1LI1 cloning plasmid
CSB-CL897312HU-10ug	Cusabio	10ug	EUR 549
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1572 Sequence: ATGGCGGCCGTGGGGCGAGTCGGCTCCTTCGGTTCTTCTCCGCCGGGATTATCCTCGACTTACACTGGCGGCCCCTTGGGCAACGAGATAGCGTCGGGCAACGGTGGCGCCGCGGCAGGCGACGACGAGGACGGGCAGAACCTTTGGTCCTGCATCCTCAGCGAGGTCTCCACCC Show more
Description: A cloning plasmid for the DYNC1LI1 gene.

Anti-DYNC1LI1 antibody
PAab02585	Lifescience Market	100 ug	EUR 412

Recombinant human DYNC1LI1
P2454	FN Test	100ug	Ask for price
Uniprot ID: Q9Y6G9 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DYNC1LI1

Rat DYNC1LI1 shRNA Plasmid
20-abx988021	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Chicken DYNC1LI1 ELISA KIT
ELI-08968c	Lifescience Market	96 Tests	EUR 928

DYNC1LI1 ELISA KIT|Human
EF009254	Lifescience Market	96 Tests	EUR 689

Mouse Dync1li1 ELISA KIT
ELI-46844m	Lifescience Market	96 Tests	EUR 865

Human DYNC1LI1 ELISA KIT
ELI-32127h	Lifescience Market	96 Tests	EUR 824

Human DYNC1LI1 shRNA Plasmid
20-abx959559	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DYNC1LI1 shRNA Plasmid
20-abx982235	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DYNC1LI1 Antibody, HRP conjugated
1-CSB-PA897312LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DYNC1LI1 Antibody, FITC conjugated
1-CSB-PA897312LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DYNC1LI1 Antibody, Biotin conjugated
1-CSB-PA897312LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DYNC1LI1. Recognizes DYNC1LI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DYNC1LI1 Recombinant Protein (Human)
RP038680	ABM	100 ug	Ask for price

DYNC1LI1 Recombinant Protein (Rat)
RP198878	ABM	100 ug	Ask for price

DYNC1LI1 Recombinant Protein (Mouse)
RP130412	ABM	100 ug	Ask for price

Dync1li1 ORF Vector (Rat) (pORF)
ORF066294	ABM	1.0 ug DNA	EUR 506

Dync1li1 ORF Vector (Mouse) (pORF)
ORF043472	ABM	1.0 ug DNA	EUR 506

DYNC1LI1 ORF Vector (Human) (pORF)
ORF012894	ABM	1.0 ug DNA	EUR 354

DYNC1LI1 sgRNA CRISPR Lentivector set (Human)
K0643401	ABM	3 x 1.0 ug	EUR 339

Dync1li1 sgRNA CRISPR Lentivector set (Mouse)
K4994701	ABM	3 x 1.0 ug	EUR 339

Dync1li1 sgRNA CRISPR Lentivector set (Rat)
K7355501	ABM	3 x 1.0 ug	EUR 339

DYNC1LI1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0643402	ABM	1.0 ug DNA	EUR 154

DYNC1LI1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0643403	ABM	1.0 ug DNA	EUR 154

DYNC1LI1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0643404	ABM	1.0 ug DNA	EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4994702	ABM	1.0 ug DNA	EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4994703	ABM	1.0 ug DNA	EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4994704	ABM	1.0 ug DNA	EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7355502	ABM	1.0 ug DNA	EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7355503	ABM	1.0 ug DNA	EUR 154

Dync1li1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7355504	ABM	1.0 ug DNA	EUR 154

DYNC1LI1 Protein Vector (Human) (pPB-C-His)
PV051573	ABM	500 ng	EUR 481

DYNC1LI1 Protein Vector (Human) (pPB-N-His)
PV051574	ABM	500 ng	EUR 481

DYNC1LI1 Protein Vector (Human) (pPM-C-HA)
PV051575	ABM	500 ng	EUR 481

DYNC1LI1 Protein Vector (Human) (pPM-C-His)
PV051576	ABM	500 ng	EUR 481

DYNC1LI1 Protein Vector (Mouse) (pPB-C-His)
PV173886	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Mouse) (pPB-N-His)
PV173887	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Mouse) (pPM-C-HA)
PV173888	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Mouse) (pPM-C-His)
PV173889	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Rat) (pPB-C-His)
PV265174	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Rat) (pPB-N-His)
PV265175	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Rat) (pPM-C-HA)
PV265176	ABM	500 ng	EUR 603

DYNC1LI1 Protein Vector (Rat) (pPM-C-His)
PV265177	ABM	500 ng	EUR 603

Dync1li1 3'UTR Luciferase Stable Cell Line
TU203713	ABM	1.0 ml	Ask for price

Dync1li1 3'UTR GFP Stable Cell Line
TU155481	ABM	1.0 ml	Ask for price

DYNC1LI1 3'UTR Luciferase Stable Cell Line
TU006455	ABM	1.0 ml	EUR 1394

Dync1li1 3'UTR Luciferase Stable Cell Line
TU105481	ABM	1.0 ml	Ask for price

DYNC1LI1 3'UTR GFP Stable Cell Line
TU056455	ABM	1.0 ml	EUR 1394

Dync1li1 3'UTR GFP Stable Cell Line
TU253713	ABM	1.0 ml	Ask for price

DYNC1LI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV676063	ABM	1.0 ug DNA	EUR 682

DYNC1LI1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV676067	ABM	1.0 ug DNA	EUR 682

DYNC1LI1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV676068	ABM	1.0 ug DNA	EUR 682

Dynein Cytoplasmic 1 Light Intermediate Chain 1 (DYNC1LI1) Antibody
abx232585-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

DYNC1LI1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0643405	ABM	3 x 1.0 ug	EUR 376

Dync1li1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4994705	ABM	3 x 1.0 ug	EUR 376

Dync1li1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7355505	ABM	3 x 1.0 ug	EUR 376

Goat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) ELISA kit
E06C2277-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) ELISA kit
E06C2277-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytoplasmic dynein 1 light intermediate chain 1(DYNC1LI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.