CellXerum Serum Free Cell Culture Medium

CellXerum Serum Free Cell Culture Medium

ARSG

ARSG siRNA
20-abx900460
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG siRNA
20-abx908234
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG siRNA
20-abx908235
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSG antibody
70R-34065 100 ug
EUR 327
Description: Rabbit polyclonal ARSG antibody

Arsg antibody
70R-9308 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Arsg antibody

ARSG Antibody
ABD3797 100 ug
EUR 438

ARSG Antibody
36153-100ul 100ul
EUR 252

ARSG antibody
70R-15853 50 ul
EUR 435
Description: Rabbit polyclonal ARSG antibody

ARSG Antibody
1-CSB-PA909692
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ARSG Antibody
DF3797 200ul
EUR 304
Description: ARSG Antibody detects endogenous levels of total ARSG.

ARSG Antibody
1-CSB-PA002150GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ARSG Antibody
1-CSB-PA002150LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ARSG Antibody
1-CSB-PA008275
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

ARSG Antibody
1-CSB-PA438801
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ARSG Conjugated Antibody
C36153 100ul
EUR 397

anti- ARSG antibody
FNab00612 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: arylsulfatase G
  • Uniprot ID: Q96EG1
  • Gene ID: 22901
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against ARSG

ARSG Enzyme (Recombinant)
20-abx073379
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ARSG Polyclonal Antibody
A50049 100 µg
EUR 570.55
Description: The best epigenetics products

ARSG Rabbit pAb
A13764-100ul 100 ul
EUR 308

ARSG Rabbit pAb
A13764-200ul 200 ul
EUR 459

ARSG Rabbit pAb
A13764-20ul 20 ul
EUR 183

ARSG Rabbit pAb
A13764-50ul 50 ul
EUR 223

ARSG Rabbit pAb
A17102-100ul 100 ul
EUR 308

ARSG Rabbit pAb
A17102-200ul 200 ul
EUR 459

ARSG Rabbit pAb
A17102-20ul 20 ul
EUR 183

ARSG Rabbit pAb
A17102-50ul 50 ul
EUR 223

Arsg Blocking Peptide
33R-3523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Arsg antibody, catalog no. 70R-9308

ARSG Blocking Peptide
DF3797-BP 1mg
EUR 195

ARSG cloning plasmid
CSB-CL002150HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1578
  • Sequence: atgggctggctttttctaaaggttttgttggcgggagtgagtttctcaggatttctttatcctcttgtggatttttgcatcagtgggaaaacaagaggacagaagccaaactttgtgattattttggccgatgacatggggtggggtgacctgggagcaaactgggcagaaacaa
  • Show more
Description: A cloning plasmid for the ARSG gene.

Anti-ARSG antibody
PAab00612 100 ug
EUR 386

Anti-ARSG antibody
STJ119348 100 µl
EUR 277

Anti-ARSG antibody
STJ115711 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the sulfatase enzyme family. Sulfatases hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules. This protein displays arylsulfatase activity at acidic pH, as is typical of lysosomal sulfatases, and has been shown to localize in the lysosomes. Alternatively spliced transcript variants have been found for this gene.

Mouse ARSG shRNA Plasmid
20-abx978052
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ARSG shRNA Plasmid
20-abx989225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARSG ELISA KIT|Human
EF007921 96 Tests
EUR 689

Canine ARSG ELISA KIT
ELI-34762d 96 Tests
EUR 928

Arylsulfatase G (ARSG) Antibody
20-abx111082
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
20-abx133695
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
abx036398-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
20-abx328812
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
20-abx214560
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
20-abx242531
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
20-abx303125
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Arylsulfatase G (ARSG) Antibody
abx230612-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human ARSG shRNA Plasmid
20-abx957856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARSG protein (His tag)
30R-2949 100 ug
EUR 322
Description: Purified recombinant Human ARSG protein (His tag)

ARSG Antibody, HRP conjugated
1-CSB-PA002150LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ARSG Antibody, FITC conjugated
1-CSB-PA002150LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ARSG Antibody, Biotin conjugated
1-CSB-PA002150LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ARSG. Recognizes ARSG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Arylsulfatase G (ARSG)
1-CSB-EP002150HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 71.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Arylsulfatase G(ARSG) expressed in E.coli