Serum myokine levels after linear and flexible non-linear periodized resistance training in overweight sedentary women

Serum myokine levels after linear and flexible non-linear periodized resistance training in overweight sedentary women

This research in contrast the capability of linear-(LP) and non-linear periodized (NLP) resistance training to enhance choose myokines and metabolic parameters in overweight sedentary women. An further function was to match these variables between the overweight and lean women. Fitness- and age-matched overweight women between 28 and 43 years outdated had been randomly allotted to LP (physique fats [BF]% = 38.7 ± 2.6, n=10), NLP (BF% = 39.3 ± 2.4, n=9) and management (BF% = 39.8 ± 2.6, n=9) teams. Lean women (BF% = 29.1 ± 2.3, n=16) matched for age and health had been additionally included for baseline comparability.
Resistance training applications (12 weeks, Three d.wk-1, 9 workouts, 60 to 90% of 1-repetition most [1RM]) had been carried out with totally different periodization schemes. Glucose, insulin, interleukin (IL)-7, IL-15, and insulin-like development issue (IGF)-1 levels had been measured at baseline and after training. Overweight topics had considerably decrease IL-15, IGF-1 and increased insulin, glucose, and insulin resistance (homeostasis mannequin evaluation, HOMA-IR) than lean topics at baseline (all, P<0.05).
IL-15 and VO2max elevated considerably after NLP in contrast with CON, which was accompanied by a major lower in HOMA-IR (all, P<0.03). Muscular endurance improved considerably in each fashions after training in comparison with CON (all, P<0.01), nevertheless it elevated extra in NLP than in LP (P=0.01). Both training protocols had been equally efficient at lowering BF% and growing IGF-1, IL-7, muscle mass and bench press 1RM (P<0.01). It seems that LP and NLP are each efficient methods for enhancing well being markers in overweight women, however LP isn’t as efficient as NLP to enhance IL-15, HOMA-IR, and cardio capability.

The Effects of Serum Removal on Gene Expression and Morphological Plasticity Markers in Differentiated SH-SY5Y Cells

Despite the widespread use of the SH-SY5Y human neuroblastoma cell line in modeling human neurons in vitro, protocols for development, differentiation and experimentation differ significantly throughout the literature. Many research totally differentiate SH-SY5Y cells earlier than experimentation, to research plasticity measures in a mature, human neuronal-like cell mannequin. Prior to experimentation, serum is usually faraway from cell tradition media, to arrest the cell development cycle and synchronize cells.
However, the precise impact of this serum elimination earlier than experimentation on mature, differentiated SH-SY5Y cells has not but been described. In research utilizing differentiated SH-SY5Y cells, any impact of serum elimination on plasticity markers might affect outcomes. The goal of the present research was to systematically characterize, in differentiated, neuronal-like SH-SY5Y cells, the possibly confounding results of full serum elimination in phrases of morphological and gene expression markers of plasticity.
We measured modifications in generally used morphological markers and in genes associated to neuroplasticity and synaptogenesis, significantly in the BDNF-TrkB signaling pathway. We discovered that full serum elimination from already differentiated SH-SY5Y cells will increase neurite size, neurite branching, and the proportion of cells with a main neurite, in addition to proportion of βIII-Tubulin and MAP2 expressing cells.
Gene expression outcomes additionally point out elevated expression of PSD95 and NTRK2 expression 24 h after serum elimination. We conclude that serum deprivation in differentiated SH-SY5Y cells impacts morphology and gene expression and can probably confound plasticity-related end result measures, having vital implications for experimental design in research utilizing differentiated SH-SY5Y cells as a mannequin of human neurons.

Coronary calcification is related to elevated serum lipoprotein (a) levels in asymptomatic males over the age of 45 years: A cross-sectional research of the Korean nationwide well being checkup information

Lipoprotein a (Lp (a)) and coronary artery calcification (CAC) are markers of coronary artery and cardiovascular illnesses. However, the affiliation between Lp (a) and CAC in asymptomatic people stays unclear. In this research, we aimed to find out the affect of Lp (a) on CAC in asymptomatic people.
We included 2019 asymptomatic Korean adults who underwent testing for a coronary artery calcium rating (CACS) and Lp (a) on the Gangnam Severance Hospital Health Checkup Center in Korea from January 2017 to August 2019. Participants had been divided into 2 teams: CACS = 0 and CACS > 0. Factors affecting the CACS had been analyzed by intercourse. Because age is a serious threat issue for atherosclerosis, ≥45 years in males and ≥55 years in women, we additional divided individuals into Four subgroups (≥45 and <45 in males, ≥55 and <55 in women).
Factors affecting the CACS in the Four teams had been analyzed.There was a constructive correlation between the CACS and conventional cardiovascular threat components. Lp (a) positively correlated with the CACS in males (P < .01) and remained vital after multivariable logistic regression (P < .01). The similar outcome was noticed in males aged ≥45 years (P < .01).Lp (a) is an independently related issue of CAC and a marker of coronary atherosclerosis in asymptomatic males aged ≥45 years. In asymptomatic males aged ≥45 years, Lp (a) ought to be measured, and intensive Lp (a)-lowering remedy ought to be thought-about.

Association of Serum Vitamin D and Immunoglobulin E Levels With Severity of Allergic Rhinitis

Objective The goal of this research was to find out the affiliation of serum vitamin D and immunoglobulin E (IgE) levels with the severity of allergic rhinitis (AR). Methods This case-control research was performed at Mayo Hospital, Lahore, from June to September 2020 after acquiring moral approval. Patients of AR had been included and divided with the assistance of allergic rhinitis and its affect on bronchial asthma (ARIA) classification, into group A (circumstances), sufferers presenting with reasonable to extreme signs, and into group B (management), sufferers with delicate signs, after remedy of AR.
Serum myokine levels after linear and flexible non-linear periodized resistance training in overweight sedentary women
The imply distinction between serum IgE and serum Vitamin D levels of each teams had been in contrast by t-test. Association was decided by logistic regression and odds ratio. Results A complete of 224 sufferers had been included in the research, 112 sufferers in group A and 112 sufferers in group B. There had been 106 (47.3%) feminine and 118 (52.7%) male.
The imply age of sufferers in group A was 26.78± 8.92 years and in group B, it was 25.72±8.12 years. Mean serum vitamin D levels in group A had been 16.24±6.7 ng/ml and in group B 26.92±35 ng/ml (p=0.0001). Mean serum IgE levels in group A had been 383.69±154.86 IU/ml and in group B, they had been 373.03±106.83 IU/ml (p=0.0001).

SAA1 Antibody

10R-11514 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies

SAA1 Antibody

10R-11515 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies

SAA1 Antibody

10R-11516 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies

SAA1 Antibody

10R-11517 1 mg
EUR 261
Description: Anti-Human SAA1 Monoclonal Antibodies

SAA1 Antibody

1-CSB-PA14047A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SAA1 Antibody

1-CSB-PA020656LA01DO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SAA1. Recognizes SAA1 from Dog. This antibody is Unconjugated. Tested in the following application: ELISA

SAA1 siRNA

20-abx932382
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SAA1 siRNA

20-abx932383
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SAA1 Antibody

ABD6533 100 ug
EUR 438

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

SAA1 Rabbit pAb

A14553-100ul 100 ul
EUR 308

SAA1 Rabbit pAb

A14553-200ul 200 ul
EUR 459

SAA1 Rabbit pAb

A14553-20ul 20 ul
EUR 183

SAA1 Rabbit pAb

A14553-50ul 50 ul
EUR 223

SAA1 monkey, recombinant

4332-10
EUR 343

SAA1 monkey, recombinant

4332-1000
EUR 7162

SAA1 monkey, recombinant

4332-50
EUR 958

SAA1/2 Antibody

DF6533 200ul
EUR 304
Description: SAA1 Antibody detects endogenous levels of total SAA1/2.

Human SAA1 Protein

abx060040-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

SAA1 Conjugated Antibody

C38275 100ul
EUR 397

SAA1 cloning plasmid

CSB-CL365776HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgaagcttctcacgggcctggttttctgctccttggtcctgggtgtcagcagccgaagcttcttttcgttccttggcgaggcttttgatggggctcgggacatgtggagagcctactctgacatgagagaagccaattacatcggctcagacaaatacttccatgctcgggggaa
  • Show more
Description: A cloning plasmid for the SAA1 gene.

SAA1 Polyclonal Antibody

A52372 100 µg
EUR 570.55
Description: Ask the seller for details

SAA1 Polyclonal Antibody

A55926 100 µg
EUR 570.55
Description: kits suitable for this type of research

SAA1 Rabbit pAb

A1655-100ul 100 ul
EUR 308

SAA1 Rabbit pAb

A1655-200ul 200 ul
EUR 459

SAA1 Rabbit pAb

A1655-20ul 20 ul
EUR 183

SAA1 Rabbit pAb

A1655-50ul 50 ul
EUR 223

SAA1 Polyclonal Antibody

ABP60318-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SAA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SAA1 from Human, Mouse. This SAA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAA1 protein

SAA1 Polyclonal Antibody

ABP60318-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SAA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SAA1 from Human, Mouse. This SAA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAA1 protein

SAA1 Polyclonal Antibody

ABP60318-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SAA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SAA1 from Human, Mouse. This SAA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SAA1 protein

anti- SAA1 antibody

FNab07572 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: serum amyloid A1
  • Uniprot ID: P0DJI8
  • Gene ID: 6288
  • Research Area: Cardiovascular
Description: Antibody raised against SAA1

SAA1 Polyclonal Antibody

ES11982-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SAA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SAA1 Polyclonal Antibody

ES11982-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SAA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SAA1 antibody

PAab07572 100 ug
EUR 412

Anti-SAA1 antibody

STJ25438 100 µl
EUR 277
Description: This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.

Anti-SAA1 antibody

STJ116764 100 µl
EUR 277
Description: This gene encodes a member of the serum amyloid A family of apolipoproteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a major acute phase protein that is highly expressed in response to inflammation and tissue injury. This protein also plays an important role in HDL metabolism and cholesterol homeostasis. High levels of this protein are associated with chronic inflammatory diseases including atherosclerosis, rheumatoid arthritis, Alzheimer's disease and Crohn's disease. This protein may also be a potential biomarker for certain tumors. Alternate splicing results in multiple transcript variants that encode the same protein. A pseudogene of this gene is found on chromosome 11.

Anti-SAA1 antibody

STJ160130 1 mL C
EUR 1647

Anti-SAA1 antibody

STJ400172 1 mg
EUR 446
Description: Serum amyloid A, a family of apolipoproteins, is associated with high density lipoprotein during inflammatory states. The level of serum amyloid A (SAA) in the blood increases dramatically in response to tissue injury and inflammation. SAA also acts as a cytokine, influencing cell adhesion, migration, proliferation and aggregation. SAAs are implicated in several chronic inflammatory diseases, such as amyloidosis, atherosclerosis, and rheumatoid arthritis.

Anti-SAA1 antibody

STJ400173 1 mg
EUR 446
Description: Serum amyloid A, a family of apolipoproteins, is associated with high density lipoprotein during inflammatory states. The level of serum amyloid A (SAA) in the blood increases dramatically in response to tissue injury and inflammation. SAA also acts as a cytokine, influencing cell adhesion, migration, proliferation and aggregation. SAAs are implicated in several chronic inflammatory diseases, such as amyloidosis, atherosclerosis, and rheumatoid arthritis.

Anti-SAA1 antibody

STJ193140 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SAA1

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent

1110-1ml
EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T

20-abx184099
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

EL Transfection Reagent

20-abx098880
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163

Biolipidure-1002-Reagent

Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent

FATRR-001 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 450ml
EUR 645

LP4K Transfection Reagent

LP4K 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent

LV750A-1 1 ml
EUR 359
  • Category: Lentiviral Technology

HighGene transfection reagent

RM09014 1000μl
EUR 270
Vitamin D poor sufferers had been 24 occasions extra more likely to develop reasonable to extreme AR illness. Conclusion This research confirmed that in moderate-severe AR, IgE levels are raised statistically as in comparison with delicate AR and the deficiency of Vitamin D is related to growing severity of allergic rhinitis signs.