chat enzyme

Human Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Hu-96T 96T
EUR 647
  • Should the Human Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-48T 48T
EUR 508
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Mu-96T 96T
EUR 661
  • Should the Mouse Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-48T 48T
EUR 528
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Choline Acetyltransferase (ChAT) ELISA Kit

DLR-ChAT-Ra-96T 96T
EUR 690
  • Should the Rat Choline Acetyltransferase (ChAT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Choline Acetyltransferase (ChAT) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-48Tests 48 Tests
EUR 522

Human Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Hu-96Tests 96 Tests
EUR 724

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-48Tests 48 Tests
EUR 534

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Mu-96Tests 96 Tests
EUR 742

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-48Tests 48 Tests
EUR 558

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RDR-ChAT-Ra-96Tests 96 Tests
EUR 776

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-48Tests 48 Tests
EUR 500

Human Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Hu-96Tests 96 Tests
EUR 692

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-48Tests 48 Tests
EUR 511

Mouse Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Mu-96Tests 96 Tests
EUR 709

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-48Tests 48 Tests
EUR 534

Rat Choline Acetyltransferase (ChAT) ELISA Kit

RD-ChAT-Ra-96Tests 96 Tests
EUR 742

ChAT

CH23000 100 ul
EUR 179

ChAT

MO20019 100 ul
EUR 278

Chat/ Rat Chat ELISA Kit

ELI-04655r 96 Tests
EUR 886

CHAT antibody

20R-2847 100 ul
EUR 349
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-16378 50 ul
EUR 435
Description: Rabbit polyclonal CHAT antibody

CHAT antibody

70R-10534 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CHAT antibody

ChAT antibody

70R-10625 1 ml
EUR 693
Description: Affinity purified Chicken polyclonal ChAT antibody

CHAT antibody

70R-14948 100 ul
EUR 392
Description: Goat polyclonal CHAT antibody

CHAT Antibody

32673-100ul 100ul
EUR 252

CHAT Antibody

1-CSB-PA005314GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CHAT Antibody

1-CSB-PA005314LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CHAT Antibody

1-CSB-PA001637
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CHAT Antibody

DF6964 200ul
EUR 304
Description: CHAT Antibody detects endogenous levels of total CHAT.

CHAT antibody

70R-49541 100 ul
EUR 244
Description: Purified Polyclonal CHAT antibody

CHAT siRNA

20-abx911641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHAT Antibody

ABD6964 100 ug
EUR 438

CHAT Rabbit pAb

A13244-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A13244-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A13244-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A13244-50ul 50 ul
EUR 223

CHAT Rabbit pAb

A12420-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A12420-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A12420-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A12420-50ul 50 ul
EUR 223

CHAT Blocking Peptide

33R-8800 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHAT antibody, catalog no. 70R-10534

CHAT Blocking Peptide

DF6964-BP 1mg
EUR 195

CHAT Blocking Peptide

20-abx062416
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHAT Conjugated Antibody

C32673 100ul
EUR 397

CHAT cloning plasmid

CSB-CL005314HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atgacagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.

CHAT cloning plasmid

CSB-CL005314HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1893
  • Sequence: atggcagcaaaaactcccagcagtgaggagtctgggctgcccaaactgcccgtgcccccgctgcagcagaccctggccacgtacctgcagtgcatgcgacacttggtgtctgaggagcagttcaggaagagccaggccattgtgcagcagtttggggcccctggtggcctcggcg
  • Show more
Description: A cloning plasmid for the CHAT gene.

CHAT Rabbit mAb

A19031-100ul 100 ul
EUR 410

CHAT Rabbit mAb

A19031-200ul 200 ul
EUR 571

CHAT Rabbit mAb

A19031-20ul 20 ul
EUR 221

CHAT Rabbit mAb

A19031-50ul 50 ul
EUR 287

CHAT Rabbit pAb

A2495-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A2495-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A2495-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A2495-50ul 50 ul
EUR 223

CHAT Rabbit pAb

A16818-100ul 100 ul
EUR 308

CHAT Rabbit pAb

A16818-200ul 200 ul
EUR 459

CHAT Rabbit pAb

A16818-20ul 20 ul
EUR 183

CHAT Rabbit pAb

A16818-50ul 50 ul
EUR 223

anti- CHAT antibody

FNab01631 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: choline acetyltransferase
  • Uniprot ID: P28329
  • Gene ID: 1103
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CHAT

anti- CHAT antibody

FNab01632 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:200
  • IF: 1:50-1:500
  • Immunogen: choline acetyltransferase
  • Uniprot ID: P28329
  • Gene ID: 1103
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against CHAT

Anti-CHAT antibody

PAab01631 100 ug
EUR 355

Anti-CHAT antibody

PAab01632 100 ug
EUR 355

Anti-CHAT antibody

STJ114294 100 µl
EUR 277
Description: This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform.

Anti-CHAT antibody

STJ115210 100 µl
EUR 277
Description: This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform.

Anti-CHAT antibody

STJ119205 100 µl
EUR 277

Anti-ChAT antibody

STJ120032 100 µl
EUR 469

Anti-ChAT antibody

STJ13100065 100 µl
EUR 427

Anti-ChAT antibody

STJ13100069 100 µl
EUR 427

Anti-ChAT antibody

STJ13100072 500 µg
EUR 427

Anti-ChAT antibody

STJ13100112 100 µl
EUR 427

Anti-CHAT antibody

STJ23113 100 µl
EUR 277
Description: This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform.

CHAT Antibody, HRP conjugated

1-CSB-PA005314LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CHAT Antibody, FITC conjugated

1-CSB-PA005314LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CHAT Antibody, Biotin conjugated

1-CSB-PA005314LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CHAT. Recognizes CHAT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Choline Acetyltransferase (ChAT) Antibody

20-abx175844
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Choline Acetyltransferase (ChAT) Antibody

20-abx175845
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Choline Acetyltransferase (ChAT) Antibody

20-abx175846
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Choline Acetyltransferase (CHAT) Antibody

20-abx111605
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Choline Acetyltransferase (ChAT) Antibody

20-abx128955
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Choline Acetyltransferase (CHAT) Antibody

20-abx149276
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Choline Acetyltransferase (ChAT) Antibody

20-abx171721
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Choline Acetyltransferase (ChAT) Antibody

20-abx171722
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human ChAT ELISA Kit

EHC0756 96Tests
EUR 521

Goat ChAT ELISA Kit

EGTC0756 96Tests
EUR 521

Bovine ChAT ELISA Kit

EBC0756 96Tests
EUR 521

Canine ChAT ELISA Kit

ECC0756 96Tests
EUR 521

Chicken ChAT ELISA Kit

ECKC0756 96Tests
EUR 521

Anserini ChAT ELISA Kit

EAC0756 96Tests
EUR 521

CHAT ELISA KIT|Human

EF007268 96 Tests
EUR 689