USP47

USP47 antibody
70R-12971	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal USP47 antibody

USP47 Antibody
43345-100ul	SAB	100ul	EUR 252

USP47 Antibody
1-CSB-PA856964LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

USP47 Antibody
1-CSB-PA459673	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

USP47 Antibody
1-CSB-PA045692	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

USP47 antibody
70R-9744	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal USP47 antibody

USP47 siRNA
20-abx939241	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP47 siRNA
20-abx939242	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-USP47
PVT17428	Lifescience Market	2 ug	EUR 231

anti-USP47
YF-PA26299	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to USP47

USP47 Rabbit pAb
A15461-100ul	Abclonal	100 ul	EUR 308

USP47 Rabbit pAb
A15461-200ul	Abclonal	200 ul	EUR 459

USP47 Rabbit pAb
A15461-20ul	Abclonal	20 ul	EUR 183

USP47 Rabbit pAb
A15461-50ul	Abclonal	50 ul	EUR 223

USP47 Blocking Peptide
33R-8539	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP47 antibody, catalog no. 70R-9744

USP7/USP47 Inhibitor
B2538-1	Biovision		EUR 142

USP7/USP47 Inhibitor
B2538-5	Biovision		EUR 414

USP47 Conjugated Antibody
C43345	SAB	100ul	EUR 397

USP47 Antibody (HRP)
20-abx310482	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP47 Antibody (FITC)
20-abx310483	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP47 Antibody (Biotin)
20-abx310484	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP47 cloning plasmid
CSB-CL856964HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 474 Sequence: atgaagtccatgtcacagcttgcagttttgtcaagacggtggaagccttcagagatgaagttggatcccttccaggaggttgtattggaaagcagtagtgtggacgaattgcgagagaagcttagtgaaatcagtgggattcctttggatgatattgaatttgctaagggtagagg Show more
Description: A cloning plasmid for the USP47 gene.

USP47 Polyclonal Antibody
A61698	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

USP7/USP47 inhibitor
HY-13487	MedChemExpress	5mg	EUR 533

pENTR223-USP47 vector
PVT11753	Lifescience Market	2 ug	EUR 304

Anti-USP47 antibody
STJ117656	St John's Laboratory	100 µl	EUR 277

Anti-USP47 (5F9)
YF-MA11552	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to USP47

Anti-USP47 (1E6)
YF-MA18721	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to USP47

USP47 Antibody, HRP conjugated
1-CSB-PA856964LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USP47 Antibody, FITC conjugated
1-CSB-PA856964LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USP47 Antibody, Biotin conjugated
1-CSB-PA856964LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP47. Recognizes USP47 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal USP47 Antibody (Center)
APR04849G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP47 (Center). This antibody is tested and proven to work in the following applications:

Chicken USP47 ELISA KIT
ELI-17760c	Lifescience Market	96 Tests	EUR 928

Mouse USP47 shRNA Plasmid
20-abx978335	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human USP47 shRNA Plasmid
20-abx960418	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

USP7/USP47 Inhibitor, P 22077
2301-25	Biovision		EUR 370

USP7/USP47 Inhibitor, P 22077
2301-5	Biovision		EUR 131

USP47 Polyclonal Antibody, Biotin Conjugated
A61699	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

USP47 Polyclonal Antibody, FITC Conjugated
A61700	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

USP47 Polyclonal Antibody, HRP Conjugated
A61701	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Usp47 ORF Vector (Mouse) (pORF)
ORF061157	ABM	1.0 ug DNA	EUR 1572

Usp47 ORF Vector (Mouse) (pORF)
ORF061158	ABM	1.0 ug DNA	EUR 1572

Usp47 ORF Vector (Rat) (pORF)
ORF078711	ABM	1.0 ug DNA	EUR 2080

USP47 ORF Vector (Human) (pORF)
ORF011381	ABM	1.0 ug DNA	EUR 95

pECMV-Usp47-m-FLAG Plasmid
PVT15517	Lifescience Market	2 ug	EUR 325

Ubiquitin Specific Peptidase 47 (USP47) Antibody
20-abx211805	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 47 (USP47) Antibody
20-abx212707	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 47 (USP47) Antibody
abx122396-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 47 (USP47) Antibody
20-abx301635	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Usp47 sgRNA CRISPR Lentivector set (Rat)
K6528301	ABM	3 x 1.0 ug	EUR 339

USP47 sgRNA CRISPR Lentivector set (Human)
K2601601	ABM	3 x 1.0 ug	EUR 339

Usp47 sgRNA CRISPR Lentivector set (Mouse)
K4096501	ABM	3 x 1.0 ug	EUR 339

Monoclonal USP47 Antibody (monoclonal) (M01), Clone: 5F9
AMM04301G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human USP47 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F9. This antibody is applicable in WB and IF, E

Usp47 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6528302	ABM	1.0 ug DNA	EUR 154

Usp47 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6528303	ABM	1.0 ug DNA	EUR 154

Usp47 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6528304	ABM	1.0 ug DNA	EUR 154

USP47 sgRNA CRISPR Lentivector (Human) (Target 1)
K2601602	ABM	1.0 ug DNA	EUR 154

USP47 sgRNA CRISPR Lentivector (Human) (Target 2)
K2601603	ABM	1.0 ug DNA	EUR 154

USP47 sgRNA CRISPR Lentivector (Human) (Target 3)
K2601604	ABM	1.0 ug DNA	EUR 154

Usp47 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4096502	ABM	1.0 ug DNA	EUR 154

Usp47 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4096503	ABM	1.0 ug DNA	EUR 154

Usp47 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4096504	ABM	1.0 ug DNA	EUR 154

USP47 Protein Vector (Mouse) (pPB-C-His)
PV244626	ABM	500 ng	EUR 2319

USP47 Protein Vector (Mouse) (pPB-N-His)
PV244627	ABM	500 ng	EUR 2319

USP47 Protein Vector (Mouse) (pPM-C-HA)
PV244628	ABM	500 ng	EUR 2319

USP47 Protein Vector (Mouse) (pPM-C-His)
PV244629	ABM	500 ng	EUR 2319

USP47 Protein Vector (Mouse) (pPB-C-His)
PV244630	ABM	500 ng	EUR 2349

USP47 Protein Vector (Mouse) (pPB-N-His)
PV244631	ABM	500 ng	EUR 2349

USP47 Protein Vector (Mouse) (pPM-C-HA)
PV244632	ABM	500 ng	EUR 2349

USP47 Protein Vector (Mouse) (pPM-C-His)
PV244633	ABM	500 ng	EUR 2349

USP47 Protein Vector (Rat) (pPB-C-His)
PV314842	ABM	500 ng	EUR 2317

USP47 Protein Vector (Rat) (pPB-N-His)
PV314843	ABM	500 ng	EUR 2317

USP47 Protein Vector (Rat) (pPM-C-HA)
PV314844	ABM	500 ng	EUR 2317

USP47 Protein Vector (Rat) (pPM-C-His)
PV314845	ABM	500 ng	EUR 2317

USP47 Protein Vector (Human) (pPB-C-His)
PV045521	ABM	500 ng	EUR 329