Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
DLR-UBE2I-Hu-96T 96T
EUR 673
  • Should the Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Conjugating Enzyme E2I (UBE2I) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RDR-UBE2I-Hu-48Tests 48 Tests
EUR 544
Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RDR-UBE2I-Hu-96Tests 96 Tests
EUR 756
Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RD-UBE2I-Hu-48Tests 48 Tests
EUR 521
Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RD-UBE2I-Hu-96Tests 96 Tests
EUR 723
Ube2i/ Rat Ube2i ELISA Kit
ELI-03657r 96 Tests
EUR 886
UBE2I antibody
70R-1080 100 ug
EUR 377
Description: Rabbit polyclonal UBE2I antibody
UBE2I antibody
70R-1159 100 ug
EUR 377
Description: Rabbit polyclonal UBE2I antibody
UBE2I Antibody
32656-100ul 100ul
EUR 252
UBE2I Antibody
43252-100ul 100ul
EUR 252
UBE2I Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
UBE2I Antibody
DF6916 200ul
EUR 304
Description: UBE2I Antibody detects endogenous levels of total UBE2I.
UBE2I Antibody
BF0087 200ul
EUR 376
Description: UBE2I antibody detects endogenous levels of total UBE2I.
UBE2I Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2I Antibody
ABD6916 100 ug
EUR 438
PVT18317 2 ug
EUR 231
UBE2I Rabbit pAb
A13558-100ul 100 ul
EUR 308
UBE2I Rabbit pAb
A13558-200ul 200 ul
EUR 459
UBE2I Rabbit pAb
A13558-20ul 20 ul
EUR 183
UBE2I Rabbit pAb
A13558-50ul 50 ul
EUR 223
UBE2I Blocking Peptide
33R-4311 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2I antibody, catalog no. 70R-1080
UBE2I Blocking Peptide
33R-6431 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2I antibody, catalog no. 70R-1159
UBE2I Blocking Peptide
DF6916-BP 1mg
EUR 195
UBE2I Rabbit pAb
A0105-100ul 100 ul
EUR 308
UBE2I Rabbit pAb
A0105-200ul 200 ul
EUR 459
UBE2I Rabbit pAb
A0105-20ul 20 ul Ask for price
UBE2I Rabbit pAb
A0105-50ul 50 ul Ask for price
UBE2I Polyclonal Antibody
A-8702 100 µl
EUR 483.55
Description: kits suitable for this type of research
UBE2I Conjugated Antibody
C43252 100ul
EUR 397
UBE2I Conjugated Antibody
C32656 100ul
EUR 397
UBE2I Blocking Peptide
BF0087-BP 1mg
EUR 195
UBE2I cloning plasmid
CSB-CL025457HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaa
  • Show more
Description: A cloning plasmid for the UBE2I gene.
UBE2I cloning plasmid
CSB-CL025457HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 477
  • Sequence: atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaa
  • Show more
Description: A cloning plasmid for the UBE2I gene.
UBE2I Rabbit mAb
A4396-100ul 100 ul
EUR 410
UBE2I Rabbit mAb
A4396-200ul 200 ul
EUR 571
UBE2I Rabbit mAb
A4396-20ul 20 ul
EUR 221
UBE2I Rabbit mAb
A4396-50ul 50 ul
EUR 287
UBE2I Polyclonal Antibody
A52612 100 µg
EUR 570.55
Description: Ask the seller for details
UBE2I Rabbit pAb
A2193-100ul 100 ul
EUR 308
UBE2I Rabbit pAb
A2193-200ul 200 ul
EUR 459
UBE2I Rabbit pAb
A2193-20ul 20 ul
EUR 183
UBE2I Rabbit pAb
A2193-50ul 50 ul
EUR 223
anti-UBE2I (1B10)
LF-MA30644 100 ul
EUR 527
Description: Mouse Monoclonal to UBE2I
Anti-UBE2I antibody
STJ110908 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene.
Anti-UBE2I antibody
STJ26017 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene.
Anti-UBE2I antibody
STJ115519 100 µl
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene.
Anti-UBE2I antibody
STJ70294 100 µg
EUR 359
UBE2I Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBE2I Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBE2I Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-UBE2I UBC9 Antibody
A02295 100ug/vial
EUR 334
Anti-UBE2I/UBC9 Antibody
A02295-1 100ug/vial
EUR 334
ELA-E11134h 96 Tests
EUR 824
EF007431 96 Tests
EUR 689
Mouse UBE2I shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat UBE2I shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UBE2I shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2I recombinant monoclonal antibody
A5265 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human UBE2I for WB, IF,ELISA
Anti-UBE2I/UBC9 Antibody
PA2258 100ug/vial
EUR 294
UBE2I Recombinant Protein (Rat)
RP235559 100 ug Ask for price
PVT13017 2 ug
EUR 325
UBE2I Recombinant Protein (Human)
RP033709 100 ug Ask for price
UBE2I Recombinant Protein (Human)
RP033712 100 ug Ask for price
UBE2I Recombinant Protein (Mouse)
RP182663 100 ug Ask for price
UBE2I Recombinant Protein (Mouse)
RP182666 100 ug Ask for price
UBE2I Recombinant Protein (Mouse)
RP182669 100 ug Ask for price
Anti-UBE2I, Biotinylated antibody
STJ73262 100 µg
EUR 359
Monoclonal UBE2I Antibody, Clone: 1B10
AMM02867G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human UBE2I. The antibodies are raised in Mouse and are from clone 1B10. This antibody is applicable in WB and IHC, FC, ICC, E
Polyclonal Goat Anti-UBE2I Antibody
AMM05151G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UBE2I . This antibody is tested and proven to work in the following applications:
UBE2I Polyclonal Antibody, Biotin Conjugated
A52609 100 µg
EUR 570.55
Description: reagents widely cited
UBE2I Polyclonal Antibody, FITC Conjugated
A52610 100 µg
EUR 570.55
Description: Ask the seller for details
UBE2I Polyclonal Antibody, HRP Conjugated
A52611 100 µg
EUR 570.55
Description: The best epigenetics products