UBE2I

Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
DLR-UBE2I-Hu-96T	DL Develop	96T	EUR 673
Should the Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Conjugating Enzyme E2I (UBE2I) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RDR-UBE2I-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RDR-UBE2I-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RD-UBE2I-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Ubiquitin Conjugating Enzyme E2I (UBE2I) ELISA Kit
RD-UBE2I-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Ube2i/ Rat Ube2i ELISA Kit
ELI-03657r	Lifescience Market	96 Tests	EUR 886

UBE2I antibody
70R-1080	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal UBE2I antibody

UBE2I antibody
70R-1159	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal UBE2I antibody

UBE2I Antibody
32656-100ul	SAB	100ul	EUR 252

UBE2I Antibody
43252-100ul	SAB	100ul	EUR 252

UBE2I Antibody
1-CSB-PA00474A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

UBE2I Antibody
DF6916	Affbiotech	200ul	EUR 304
Description: UBE2I Antibody detects endogenous levels of total UBE2I.

UBE2I Antibody
BF0087	Affbiotech	200ul	EUR 376
Description: UBE2I antibody detects endogenous levels of total UBE2I.

UBE2I Antibody
1-CSB-PA025457GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

UBE2I siRNA
20-abx905909	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBE2I siRNA
20-abx938782	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBE2I siRNA
20-abx938783	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBE2I Antibody
ABD6916	Lifescience Market	100 ug	EUR 438

pOTB7-UBE2I
PVT18317	Lifescience Market	2 ug	EUR 231

UBE2I Rabbit pAb
A13558-100ul	Abclonal	100 ul	EUR 308

UBE2I Rabbit pAb
A13558-200ul	Abclonal	200 ul	EUR 459

UBE2I Rabbit pAb
A13558-20ul	Abclonal	20 ul	EUR 183

UBE2I Rabbit pAb
A13558-50ul	Abclonal	50 ul	EUR 223

UBE2I Blocking Peptide
33R-4311	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2I antibody, catalog no. 70R-1080

UBE2I Blocking Peptide
33R-6431	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2I antibody, catalog no. 70R-1159

UBE2I Blocking Peptide
DF6916-BP	Affbiotech	1mg	EUR 195

UBE2I Rabbit pAb
A0105-100ul	Abclonal	100 ul	EUR 308

UBE2I Rabbit pAb
A0105-200ul	Abclonal	200 ul	EUR 459

UBE2I Rabbit pAb
A0105-20ul	Abclonal	20 ul	Ask for price

UBE2I Rabbit pAb
A0105-50ul	Abclonal	50 ul	Ask for price

UBE2I Polyclonal Antibody
A-8702	EpiGentek	100 µl	EUR 483.55
Description: kits suitable for this type of research

UBE2I Conjugated Antibody
C43252	SAB	100ul	EUR 397

UBE2I Conjugated Antibody
C32656	SAB	100ul	EUR 397

UBE2I Blocking Peptide
BF0087-BP	Affbiotech	1mg	EUR 195

UBE2I cloning plasmid
CSB-CL025457HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 555 Sequence: atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaa Show more
Description: A cloning plasmid for the UBE2I gene.

UBE2I cloning plasmid
CSB-CL025457HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 477 Sequence: atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaa Show more
Description: A cloning plasmid for the UBE2I gene.

UBE2I Rabbit mAb
A4396-100ul	Abclonal	100 ul	EUR 410

UBE2I Rabbit mAb
A4396-200ul	Abclonal	200 ul	EUR 571

UBE2I Rabbit mAb
A4396-20ul	Abclonal	20 ul	EUR 221

UBE2I Rabbit mAb
A4396-50ul	Abclonal	50 ul	EUR 287

UBE2I Polyclonal Antibody
A52612	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

UBE2I Rabbit pAb
A2193-100ul	Abclonal	100 ul	EUR 308

UBE2I Rabbit pAb
A2193-200ul	Abclonal	200 ul	EUR 459

UBE2I Rabbit pAb
A2193-20ul	Abclonal	20 ul	EUR 183

UBE2I Rabbit pAb
A2193-50ul	Abclonal	50 ul	EUR 223

anti-UBE2I (1B10)
LF-MA30644	Abfrontier	100 ul	EUR 527
Description: Mouse Monoclonal to UBE2I

Anti-UBE2I antibody
STJ110908	St John's Laboratory	100 µl	EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-UBE2I antibody
STJ26017	St John's Laboratory	100 µl	EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-UBE2I antibody
STJ115519	St John's Laboratory	100 µl	EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-UBE2I antibody
STJ70294	St John's Laboratory	100 µg	EUR 359

UBE2I Antibody, HRP conjugated
1-CSB-PA00474B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBE2I Antibody, FITC conjugated
1-CSB-PA00474C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBE2I Antibody, Biotin conjugated
1-CSB-PA00474D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2I. Recognizes UBE2I from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-UBE2I UBC9 Antibody
A02295	BosterBio	100ug/vial	EUR 334

Anti-UBE2I/UBC9 Antibody
A02295-1	BosterBio	100ug/vial	EUR 334

Human UBE2I ELISA Kit
ELA-E11134h	Lifescience Market	96 Tests	EUR 824

UBE2I ELISA KIT\|Human
EF007431	Lifescience Market	96 Tests	EUR 689

Mouse UBE2I shRNA Plasmid
20-abx973285	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat UBE2I shRNA Plasmid
20-abx985131	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UBE2I shRNA Plasmid
20-abx955012	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UBE2I recombinant monoclonal antibody
A5265	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human UBE2I for WB, IF,ELISA

Anti-UBE2I/UBC9 Antibody
PA2258	BosterBio	100ug/vial	EUR 294

UBE2I Recombinant Protein (Rat)
RP235559	ABM	100 ug	Ask for price

pECMV-3-FLAG-UBE2I
PVT13017	Lifescience Market	2 ug	EUR 325

UBE2I Recombinant Protein (Human)
RP033709	ABM	100 ug	Ask for price

UBE2I Recombinant Protein (Human)
RP033712	ABM	100 ug	Ask for price

UBE2I Recombinant Protein (Mouse)
RP182663	ABM	100 ug	Ask for price

UBE2I Recombinant Protein (Mouse)
RP182666	ABM	100 ug	Ask for price

UBE2I Recombinant Protein (Mouse)
RP182669	ABM	100 ug	Ask for price

Anti-UBE2I, Biotinylated antibody
STJ73262	St John's Laboratory	100 µg	EUR 359

Monoclonal UBE2I Antibody, Clone: 1B10
AMM02867G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human UBE2I. The antibodies are raised in Mouse and are from clone 1B10. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal Goat Anti-UBE2I Antibody
AMM05151G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UBE2I . This antibody is tested and proven to work in the following applications:

UBE2I Polyclonal Antibody, Biotin Conjugated
A52609	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

UBE2I Polyclonal Antibody, FITC Conjugated
A52610	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

UBE2I Polyclonal Antibody, HRP Conjugated
A52611	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products