TUBA1A

TUBA1A siRNA
20-abx905863
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA1A siRNA
20-abx938539
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA1A siRNA
20-abx938540
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA1A antibody
70R-21055 50 ul
EUR 435
Description: Rabbit polyclonal TUBA1A antibody
TUBA1A Antibody
CSB-PA979507-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
TUBA1A Antibody
CSB-PA979507-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
TUBA1A Antibody
1-CSB-PA005532
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TUBA1A Antibody
1-CSB-PA754656LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TUBA1A Antibody
1-CSB-PA025306GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
TUBA1A / TUBA1B Antibody
20-abx327000
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B Antibody
20-abx328602
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B Antibody
20-abx329649
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A Polyclonal Antibody
A61610 100 µg
EUR 570.55
Description: Ask the seller for details
TUBA1A/TUBA1B Antibody
1-CSB-PA000353
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000
TUBA1A/TUBA1B Antibody
1-CSB-PA004344
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000
TUBA1A/TUBA1B Antibody
1-CSB-PA004665
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.03% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B. Recognizes TUBA1A/TUBA1B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
TUBA1A cloning plasmid
CSB-CL754656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1356
  • Sequence: atgcgtgagtgcatctccatccacgttggccaggctggtgtccagattggcaatgcctgctgggagctctactgcctggaacacggcatccagcccgatggccagatgccaagtgacaagaccattgggggaggagatgattccttcaacaccttcttcagtgagacgggggctg
  • Show more
Description: A cloning plasmid for the TUBA1A gene.
Rat TUBA1A shRNA Plasmid
20-abx986165
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Tubulin Beta (TUBA1A) Antibody
abx145794-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody
20-abx134673
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody
20-abx327432
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody
20-abx327495
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody
20-abx327496
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody
abx332324-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody
20-abx301447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human TUBA1A shRNA Plasmid
20-abx955292
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TUBA1A shRNA Plasmid
20-abx973252
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Acetyl-TUBA1A (K40) Antibody
1-CSB-PA000127
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-TUBA1A (K40). Recognizes Acetyl-TUBA1A (K40) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Acetyl-TUBA1A (K352) Antibody
1-CSB-PA000128
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-TUBA1A (K352). Recognizes Acetyl-TUBA1A (K352) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TUBA1A Antibody, HRP conjugated
1-CSB-PA754656LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TUBA1A Antibody, FITC conjugated
1-CSB-PA754656LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TUBA1A Antibody, Biotin conjugated
1-CSB-PA754656LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA1A. Recognizes TUBA1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TUBA1A Recombinant Protein (Human)
RP033391 100 ug Ask for price
TUBA1A Recombinant Protein (Rat)
RP235250 100 ug Ask for price
TUBA1A Recombinant Protein (Mouse)
RP182210 100 ug Ask for price
pCMV-Flag-TUBA1A Plasmid
PVTB00435-2a 2 ug
EUR 356
Tubulin, Alpha 1A (TUBA1A) Antibody
20-abx116344
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Alpha 1a (TUBA1A) Antibody
20-abx159736
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody (HRP)
20-abx307999
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody (FITC)
20-abx308000
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Beta (TUBA1A) Antibody (Biotin)
20-abx308001
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A Polyclonal Antibody, Biotin Conjugated
A61611 100 µg
EUR 570.55
Description: The best epigenetics products
TUBA1A Polyclonal Antibody, FITC Conjugated
A61612 100 µg
EUR 570.55
Description: kits suitable for this type of research
TUBA1A Polyclonal Antibody, HRP Conjugated
A61613 100 µg
EUR 570.55
Description: fast delivery possible
Tuba1a ORF Vector (Rat) (pORF)
ORF078418 1.0 ug DNA
EUR 506
TUBA1A ORF Vector (Human) (pORF)
ORF011131 1.0 ug DNA
EUR 95
Tuba1a ORF Vector (Mouse) (pORF)
ORF060738 1.0 ug DNA
EUR 506
TUBA1A ELISA Kit (Human) (OKEH07712)
OKEH07712 96 Wells
EUR 896
Description: Description of target: Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blot studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, intellectual disability, and early-onset epilepsy caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.8pg/mL
Polyclonal TUBA1A antibody - C-terminal region
AMM08368G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBA1A - C-terminal region. This antibody is tested and proven to work in the following applications:
Acetyl-TUBA1A / TUBA1B / TUBA1C (K112) Antibody
20-abx327430
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA4A Antibody
20-abx327431
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A sgRNA CRISPR Lentivector set (Human)
K2557101 3 x 1.0 ug
EUR 339
Tuba1a sgRNA CRISPR Lentivector set (Mouse)
K4528101 3 x 1.0 ug
EUR 339
Acetyl-TUBA1A/TUBA1B/TUBA1C (K112) Antibody
1-CSB-PA000134
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-TUBA1A/TUBA1B/TUBA1C (K112). Recognizes Acetyl-TUBA1A/TUBA1B/TUBA1C (K112) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A Antibody
1-CSB-PA005736
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Tuba1a sgRNA CRISPR Lentivector set (Rat)
K6967201 3 x 1.0 ug
EUR 339
Monoclonal TUBA1A Antibody Monoclonal (M06), Clone: 2D2
AMM08369G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TUBA1A Monoclonal (M06). The antibodies are raised in mouse and are from clone 2D2. This antibody is applicable in WB and IF, E
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA3E / TUBA4A Antibody
20-abx327137
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Tubulin Alpha 1A (TUBA1A) ELISA Kit
20-abx259393
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA8 / TUBA4A Antibody
20-abx329824
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A sgRNA CRISPR Lentivector (Human) (Target 1)
K2557102 1.0 ug DNA
EUR 154
TUBA1A sgRNA CRISPR Lentivector (Human) (Target 2)
K2557103 1.0 ug DNA
EUR 154
TUBA1A sgRNA CRISPR Lentivector (Human) (Target 3)
K2557104 1.0 ug DNA
EUR 154
Tuba1a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4528102 1.0 ug DNA
EUR 154
Tuba1a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4528103 1.0 ug DNA
EUR 154
Tuba1a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4528104 1.0 ug DNA
EUR 154
TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA8/TUBA4A Antibody
1-CSB-PA193238
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA8/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA8/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000
TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA3E/TUBA4A Antibody
1-CSB-PA060126
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA3E/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA3E/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
Tuba1a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6967202 1.0 ug DNA
EUR 154
Tuba1a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6967203 1.0 ug DNA
EUR 154
Tuba1a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6967204 1.0 ug DNA
EUR 154
TUBA1A Protein Vector (Human) (pPB-C-His)
PV044521 500 ng
EUR 329
TUBA1A Protein Vector (Human) (pPB-N-His)
PV044522 500 ng
EUR 329
TUBA1A Protein Vector (Human) (pPM-C-HA)
PV044523 500 ng
EUR 329
TUBA1A Protein Vector (Human) (pPM-C-His)
PV044524 500 ng
EUR 329