  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRIM14 antibody
70R-20975 50 ul
EUR 435
Description: Rabbit polyclonal TRIM14 antibody
TRIM14 Antibody
40149-100ul 100ul
EUR 252
TRIM14 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150
TRIM14 Antibody
DF12490 200ul
EUR 304
Description: TRIM14 antibody detects endogenous levels of TRIM14.
TRIM14 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
TRIM14 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TRIM14 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TRIM14 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
PVT14004 2 ug
EUR 391
YF-PA16544 50 ul
EUR 363
Description: Mouse polyclonal to TRIM14
YF-PA16545 50 ug
EUR 363
Description: Mouse polyclonal to TRIM14
YF-PA16546 100 ug
EUR 403
Description: Rabbit polyclonal to TRIM14
TRIM14 Conjugated Antibody
C40149 100ul
EUR 397
TRIM14 cloning plasmid
CSB-CL614516HU-10ug 10ug
EUR 482
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1329
  • Sequence: atggcgggcgcggcgaccgggagccggacccctgggaggtcggagcttgtcgagggatgcggctggcgctgcccggagcatggcgaccgcgtggctgagctcttctgtcgccgctgccgccgctgcgtgtgcgcgctttgcccggtgctgggcgcgcaccgtggccaccctgtgg
  • Show more
Description: A cloning plasmid for the TRIM14 gene.
anti- TRIM14 antibody
FNab08968 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: tripartite motif-containing 14
  • Uniprot ID: Q14142
  • Gene ID: 9830
  • Research Area: Immunology, Metabolism, Developmental biology
Description: Antibody raised against TRIM14
TRIM14 Blocking Peptide
DF12490-BP 1mg
EUR 195
Anti-TRIM14 antibody
PAab08968 100 ug
EUR 412
PVT14023 2 ug
EUR 599
Mouse TRIM14 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRIM14 ELISA Kit
EH13190 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14142
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
EF003815 96 Tests
EUR 689
Human TRIM14 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRIM14 Recombinant Protein (Human)
RP032869 100 ug Ask for price
TRIM14 Recombinant Protein (Rat)
RP234644 100 ug Ask for price
TRIM14 Recombinant Protein (Mouse)
RP181058 100 ug Ask for price
Polyclonal TRIM14 antibody - middle region
APR00577G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM14 - middle region. This antibody is tested and proven to work in the following applications:
Trim14 ORF Vector (Rat) (pORF)
ORF078216 1.0 ug DNA
EUR 506
TRIM14 ORF Vector (Human) (pORF)
ORF010957 1.0 ug DNA
EUR 95
Trim14 ORF Vector (Mouse) (pORF)
ORF060354 1.0 ug DNA
EUR 506
Polyclonal TRIM14 antibody - N-terminal region
APR00664G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM14 - N-terminal region. This antibody is tested and proven to work in the following applications:
Tripartite Motif-Containing 14 (TRIM14) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif-Containing 14 (TRIM14) Antibody
abx238968-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Tripartite Motif-Containing 14 (TRIM14) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif-Containing 14 (TRIM14) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif-Containing 14 (TRIM14) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tripartite Motif-Containing 14 (TRIM14) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TRIM14 sgRNA CRISPR Lentivector set (Human)
K2464101 3 x 1.0 ug
EUR 339
Trim14 sgRNA CRISPR Lentivector set (Mouse)
K4084201 3 x 1.0 ug
EUR 339
Trim14 sgRNA CRISPR Lentivector set (Rat)
K6473501 3 x 1.0 ug
EUR 339
TRIM14 sgRNA CRISPR Lentivector (Human) (Target 1)
K2464102 1.0 ug DNA
EUR 154
TRIM14 sgRNA CRISPR Lentivector (Human) (Target 2)
K2464103 1.0 ug DNA
EUR 154
TRIM14 sgRNA CRISPR Lentivector (Human) (Target 3)
K2464104 1.0 ug DNA
EUR 154
Trim14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4084202 1.0 ug DNA
EUR 154
Trim14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4084203 1.0 ug DNA
EUR 154
Trim14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4084204 1.0 ug DNA
EUR 154
Trim14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6473502 1.0 ug DNA
EUR 154
Trim14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6473503 1.0 ug DNA
EUR 154
Trim14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6473504 1.0 ug DNA
EUR 154
TRIM14 Protein Vector (Human) (pPB-C-His)
PV043825 500 ng
EUR 329
TRIM14 Protein Vector (Human) (pPB-N-His)
PV043826 500 ng
EUR 329
TRIM14 Protein Vector (Human) (pPM-C-HA)
PV043827 500 ng
EUR 329
TRIM14 Protein Vector (Human) (pPM-C-His)
PV043828 500 ng
EUR 329
TRIM14 Protein Vector (Rat) (pPB-C-His)
PV312862 500 ng
EUR 603
TRIM14 Protein Vector (Rat) (pPB-N-His)
PV312863 500 ng
EUR 603
TRIM14 Protein Vector (Rat) (pPM-C-HA)
PV312864 500 ng
EUR 603
TRIM14 Protein Vector (Rat) (pPM-C-His)
PV312865 500 ng
EUR 603
TRIM14 Protein Vector (Mouse) (pPB-C-His)
PV241414 500 ng
EUR 603
TRIM14 Protein Vector (Mouse) (pPB-N-His)
PV241415 500 ng
EUR 603
TRIM14 Protein Vector (Mouse) (pPM-C-HA)
PV241416 500 ng
EUR 603
TRIM14 Protein Vector (Mouse) (pPM-C-His)
PV241417 500 ng
EUR 603
Trim14 3'UTR GFP Stable Cell Line
TU171077 1.0 ml Ask for price
TRIM14 3'UTR GFP Stable Cell Line
TU076525 1.0 ml
EUR 2333
Trim14 3'UTR Luciferase Stable Cell Line
TU121077 1.0 ml Ask for price
TRIM14 3'UTR Luciferase Stable Cell Line
TU026525 1.0 ml
EUR 2333
Trim14 3'UTR Luciferase Stable Cell Line
TU222424 1.0 ml Ask for price
Trim14 3'UTR GFP Stable Cell Line
TU272424 1.0 ml Ask for price
Human Tripartite Motif-Containing 14 (TRIM14) ELISA Kit
abx383920-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
TRIM14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV669511 1.0 ug DNA
EUR 682
TRIM14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV669515 1.0 ug DNA
EUR 682
TRIM14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV669516 1.0 ug DNA
EUR 682
Mouse Tripartite motif- containing protein 14, Trim14 ELISA KIT
ELI-17886m 96 Tests
EUR 865
Human Tripartite motif- containing protein 14, TRIM14 ELISA KIT
ELI-40097h 96 Tests
EUR 824
TRIM14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2464105 3 x 1.0 ug
EUR 376
Trim14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4084205 3 x 1.0 ug
EUR 376