TRIM14

TRIM14 Antibody
40149-100ul	SAB	100ul	EUR 252

TRIM14 Antibody
1-CSB-PA908056	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:30-1:150

TRIM14 Antibody
DF12490	Affbiotech	200ul	EUR 304
Description: TRIM14 antibody detects endogenous levels of TRIM14.

TRIM14 Antibody
1-CSB-PA436398	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TRIM14 Antibody
1-CSB-PA577609	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRIM14 Antibody
1-CSB-PA227800	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRIM14 Antibody
1-CSB-PA024451GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRIM14. Recognizes TRIM14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

TRIM14 siRNA
20-abx938015	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRIM14 siRNA
20-abx938016	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-TRIM14
PVT14004	Lifescience Market	2 ug	EUR 391

anti-TRIM14
YF-PA16544	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to TRIM14

anti-TRIM14
YF-PA16545	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TRIM14

anti-TRIM14
YF-PA16546	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TRIM14

TRIM14 Blocking Peptide
DF12490-BP	Affbiotech	1mg	EUR 195

TRIM14 Conjugated Antibody
C40149	SAB	100ul	EUR 397

TRIM14 cloning plasmid
CSB-CL614516HU-10ug	Cusabio	10ug	EUR 482
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1329 Sequence: atggcgggcgcggcgaccgggagccggacccctgggaggtcggagcttgtcgagggatgcggctggcgctgcccggagcatggcgaccgcgtggctgagctcttctgtcgccgctgccgccgctgcgtgtgcgcgctttgcccggtgctgggcgcgcaccgtggccaccctgtgg Show more
Description: A cloning plasmid for the TRIM14 gene.

anti- TRIM14 antibody
FNab08968	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: tripartite motif-containing 14 Uniprot ID: Q14142 Gene ID: 9830 Research Area: Immunology, Metabolism, Developmental biology
Description: Antibody raised against TRIM14

Anti-TRIM14 antibody
PAab08968	Lifescience Market	100 ug	EUR 412

pCAGGS-HA-TRIM14
PVT14023	Lifescience Market	2 ug	EUR 599

Human TRIM14 ELISA Kit
EH13190	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q14142
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

TRIM14 ELISA KIT|Human
EF003815	Lifescience Market	96 Tests	EUR 689

Mouse TRIM14 shRNA Plasmid
20-abx978304	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TRIM14 shRNA Plasmid
20-abx956585	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TRIM14 Recombinant Protein (Rat)
RP234644	ABM	100 ug	Ask for price

TRIM14 Recombinant Protein (Human)
RP032869	ABM	100 ug	Ask for price

TRIM14 Recombinant Protein (Mouse)
RP181058	ABM	100 ug	Ask for price

Polyclonal TRIM14 antibody - middle region
APR00577G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM14 - middle region. This antibody is tested and proven to work in the following applications:

Trim14 ORF Vector (Rat) (pORF)
ORF078216	ABM	1.0 ug DNA	EUR 506

TRIM14 ORF Vector (Human) (pORF)
ORF010957	ABM	1.0 ug DNA	EUR 95

Trim14 ORF Vector (Mouse) (pORF)
ORF060354	ABM	1.0 ug DNA	EUR 506

Polyclonal TRIM14 antibody - N-terminal region
APR00664G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM14 - N-terminal region. This antibody is tested and proven to work in the following applications:

Tripartite Motif-Containing 14 (TRIM14) Antibody
20-abx210731	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif-Containing 14 (TRIM14) Antibody
20-abx210732	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif-Containing 14 (TRIM14) Antibody
20-abx213213	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif-Containing 14 (TRIM14) Antibody
20-abx213282	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif-Containing 14 (TRIM14) Antibody
20-abx116267	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tripartite Motif-Containing 14 (TRIM14) Antibody
abx238968-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Trim14 sgRNA CRISPR Lentivector set (Rat)
K6473501	ABM	3 x 1.0 ug	EUR 339

TRIM14 sgRNA CRISPR Lentivector set (Human)
K2464101	ABM	3 x 1.0 ug	EUR 339

Trim14 sgRNA CRISPR Lentivector set (Mouse)
K4084201	ABM	3 x 1.0 ug	EUR 339

Trim14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6473502	ABM	1.0 ug DNA	EUR 154

Trim14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6473503	ABM	1.0 ug DNA	EUR 154

Trim14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6473504	ABM	1.0 ug DNA	EUR 154

TRIM14 sgRNA CRISPR Lentivector (Human) (Target 1)
K2464102	ABM	1.0 ug DNA	EUR 154

TRIM14 sgRNA CRISPR Lentivector (Human) (Target 2)
K2464103	ABM	1.0 ug DNA	EUR 154

TRIM14 sgRNA CRISPR Lentivector (Human) (Target 3)
K2464104	ABM	1.0 ug DNA	EUR 154

Trim14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4084202	ABM	1.0 ug DNA	EUR 154

Trim14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4084203	ABM	1.0 ug DNA	EUR 154

Trim14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4084204	ABM	1.0 ug DNA	EUR 154

TRIM14 Protein Vector (Rat) (pPB-C-His)
PV312862	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Rat) (pPB-N-His)
PV312863	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Rat) (pPM-C-HA)
PV312864	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Rat) (pPM-C-His)
PV312865	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Mouse) (pPB-C-His)
PV241414	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Mouse) (pPB-N-His)
PV241415	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Mouse) (pPM-C-HA)
PV241416	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Mouse) (pPM-C-His)
PV241417	ABM	500 ng	EUR 603

TRIM14 Protein Vector (Human) (pPB-C-His)
PV043825	ABM	500 ng	EUR 329

TRIM14 Protein Vector (Human) (pPB-N-His)
PV043826	ABM	500 ng	EUR 329

TRIM14 Protein Vector (Human) (pPM-C-HA)
PV043827	ABM	500 ng	EUR 329

TRIM14 Protein Vector (Human) (pPM-C-His)
PV043828	ABM	500 ng	EUR 329

Trim14 3'UTR Luciferase Stable Cell Line
TU121077	ABM	1.0 ml	Ask for price

Trim14 3'UTR GFP Stable Cell Line
TU171077	ABM	1.0 ml	Ask for price

Trim14 3'UTR Luciferase Stable Cell Line
TU222424	ABM	1.0 ml	Ask for price

TRIM14 3'UTR GFP Stable Cell Line
TU076525	ABM	1.0 ml	EUR 2333

TRIM14 3'UTR Luciferase Stable Cell Line
TU026525	ABM	1.0 ml	EUR 2333

Trim14 3'UTR GFP Stable Cell Line
TU272424	ABM	1.0 ml	Ask for price

Human Tripartite Motif-Containing 14 (TRIM14) ELISA Kit
abx383920-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TRIM14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV669511	ABM	1.0 ug DNA	EUR 682

TRIM14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV669515	ABM	1.0 ug DNA	EUR 682

TRIM14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV669516	ABM	1.0 ug DNA	EUR 682

Mouse Tripartite motif- containing protein 14, Trim14 ELISA KIT
ELI-17886m	Lifescience Market	96 Tests	EUR 865

Human Tripartite motif- containing protein 14, TRIM14 ELISA KIT
ELI-40097h	Lifescience Market	96 Tests	EUR 824

Trim14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6473505	ABM	3 x 1.0 ug	EUR 376

TRIM14 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2464105	ABM	3 x 1.0 ug	EUR 376