TGFA

Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Hu-96T	DL Develop	96T	EUR 548
Should the Human Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Mu-48T	DL Develop	48T	EUR 435
Should the Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Mu-96T	DL Develop	96T	EUR 561
Should the Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Ra-48T	DL Develop	48T	EUR 454
Should the Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Ra-96T	DL Develop	96T	EUR 587
Should the Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Si-48T	DL Develop	48T	EUR 522
Should the Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Si-96T	DL Develop	96T	EUR 681
Should the Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418

Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575

Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Mu-48Tests	Reddot Biotech	48 Tests	EUR 429

Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Mu-96Tests	Reddot Biotech	96 Tests	EUR 591

Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Ra-48Tests	Reddot Biotech	48 Tests	EUR 450

Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Ra-96Tests	Reddot Biotech	96 Tests	EUR 622

Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Si-48Tests	Reddot Biotech	48 Tests	EUR 527

Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Si-96Tests	Reddot Biotech	96 Tests	EUR 731

Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Mu-48Tests	Reddot Biotech	48 Tests	EUR 447

Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Mu-96Tests	Reddot Biotech	96 Tests	EUR 618

Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Ra-48Tests	Reddot Biotech	48 Tests	EUR 470

Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Ra-96Tests	Reddot Biotech	96 Tests	EUR 651

Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Si-48Tests	Reddot Biotech	48 Tests	EUR 551

Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Si-96Tests	Reddot Biotech	96 Tests	EUR 765

TGFa protein
30R-3170	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant TGFa protein

TGFA Antibody
35957-100ul	SAB	100ul	EUR 252

TGFA antibody
38131-100ul	SAB	100ul	EUR 252

TGFA Antibody
1-CSB-PA004275	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

TGFA Antibody
1-CSB-PA07294A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TGFA Antibody
CSB-PA799735-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

TGFA Antibody
CSB-PA799735-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

TGFA Antibody
DF6099	Affbiotech	200ul	EUR 304
Description: TGFA Antibody detects endogenous levels of total TGFA.

TGFA Antibody
1-CSB-PA582653	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

TGFA siRNA
20-abx905543	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGFA siRNA
20-abx936610	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGFA siRNA
20-abx936611	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TGFA Antibody
ABD6099	Lifescience Market	100 ug	EUR 438

TGFA Rabbit pAb
A12516-100ul	Abclonal	100 ul	EUR 308

TGFA Rabbit pAb
A12516-200ul	Abclonal	200 ul	EUR 459

TGFA Rabbit pAb
A12516-20ul	Abclonal	20 ul	EUR 183

TGFA Rabbit pAb
A12516-50ul	Abclonal	50 ul	EUR 223

TGFA Rabbit pAb
A12522-100ul	Abclonal	100 ul	EUR 308

TGFA Rabbit pAb
A12522-200ul	Abclonal	200 ul	EUR 459

TGFA Rabbit pAb
A12522-20ul	Abclonal	20 ul	EUR 183

TGFA Rabbit pAb
A12522-50ul	Abclonal	50 ul	EUR 223

TGFA Blocking Peptide
DF6099-BP	Affbiotech	1mg	EUR 195

TGFA Rabbit pAb
A0337-100ul	Abclonal	100 ul	EUR 308

TGFA Rabbit pAb
A0337-200ul	Abclonal	200 ul	EUR 459

TGFA Rabbit pAb
A0337-20ul	Abclonal	20 ul	EUR 183

TGFA Rabbit pAb
A0337-50ul	Abclonal	50 ul	EUR 223

Rabbit TGFa Protein
20-abx069421	Abbexa	EUR 801.00 EUR 300.00 EUR 2513.00 EUR 954.00 EUR 565.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TGFA Conjugated Antibody
C35957	SAB	100ul	EUR 397

TGFA cloning plasmid
CSB-CL023445HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 480 Sequence: atggtcccctcggctggacagctcgccctgttcgctctgggtattgtgttggctgcgtgccaggccttggagaacagcacgtccccgctgagtgacccgcccgtggctgcagcagtggtgtcccattttaatgactgcccagattcccacactcagttctgcttccatggaacctg Show more
Description: A cloning plasmid for the TGFA gene.

TGFA Polyclonal Antibody
A54053	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Anti-TGFA antibody
STJ114390	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-TGFA antibody
STJ114396	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-TGFA antibody
STJ29797	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

TGFA Antibody, HRP conjugated
1-CSB-PA07294B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TGFA Antibody, FITC conjugated
1-CSB-PA07294C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TGFA Antibody, Biotin conjugated
1-CSB-PA07294D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TGF Alpha (TGFA) Antibody
20-abx008644	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

TGF Alpha (TGFA) Antibody
20-abx013207	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

TGF Alpha (TGFA) Antibody
abx238637-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Human TGFA ELISA Kit
ELA-E0123h	Lifescience Market	96 Tests	EUR 824

Human TGFa ELISA Kit
EHT0159	Abclonal	96Tests	EUR 521

Bovine TGFa ELISA Kit
EBT0159	Abclonal	96Tests	EUR 521

Anserini TGFa ELISA Kit
EAT0159	Abclonal	96Tests	EUR 521

Chicken TGFa ELISA Kit
ECKT0159	Abclonal	96Tests	EUR 521

Canine TGFa ELISA Kit
ECT0159	Abclonal	96Tests	EUR 521

Goat TGFa ELISA Kit
EGTT0159	Abclonal	96Tests	EUR 521

Mouse TGFA shRNA Plasmid
20-abx973084	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TGFA shRNA Plasmid
20-abx984662	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TGFalpha(TGFA/1119) Antibody
BNUM1119-50	Biotium	50uL	EUR 395
Description: Primary antibody against TGFalpha(TGFA/1119), 1mg/mL

TGFalpha(TGFA/1119) Antibody
BNUB1119-100	Biotium	100uL	EUR 209
Description: Primary antibody against TGFalpha(TGFA/1119), Concentration: 0.2mg/mL

TGFalpha(TGFA/1119) Antibody
BNUB1119-500	Biotium	500uL	EUR 458
Description: Primary antibody against TGFalpha(TGFA/1119), Concentration: 0.2mg/mL

TGFalpha(TGFA/1119) Antibody
BNC551119-100	Biotium	100uL	EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF555 conjugate, Concentration: 0.1mg/mL