TGFA

Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Hu-96T 96T
EUR 548
  • Should the Human Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Mu-48T 48T
EUR 435
  • Should the Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Mu-96T 96T
EUR 561
  • Should the Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Ra-48T 48T
EUR 454
  • Should the Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Ra-96T 96T
EUR 587
  • Should the Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Si-48T 48T
EUR 522
  • Should the Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
DLR-TGFa-Si-96T 96T
EUR 681
  • Should the Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Transforming Growth Factor Alpha (TGFa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Hu-48Tests 48 Tests
EUR 418
Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Hu-96Tests 96 Tests
EUR 575
Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Mu-48Tests 48 Tests
EUR 429
Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Mu-96Tests 96 Tests
EUR 591
Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Ra-48Tests 48 Tests
EUR 450
Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Ra-96Tests 96 Tests
EUR 622
Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Si-48Tests 48 Tests
EUR 527
Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RD-TGFa-Si-96Tests 96 Tests
EUR 731
Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Hu-48Tests 48 Tests
EUR 436
Human Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Hu-96Tests 96 Tests
EUR 601
Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Mu-48Tests 48 Tests
EUR 447
Mouse Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Mu-96Tests 96 Tests
EUR 618
Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Ra-48Tests 48 Tests
EUR 470
Rat Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Ra-96Tests 96 Tests
EUR 651
Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Si-48Tests 48 Tests
EUR 551
Monkey Transforming Growth Factor Alpha (TGFa) ELISA Kit
RDR-TGFa-Si-96Tests 96 Tests
EUR 765
TGFA siRNA
20-abx905543
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFA siRNA
20-abx936610
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFA siRNA
20-abx936611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TGFA Antibody
ABD6099 100 ug
EUR 438
TGFA Antibody
35957-100ul 100ul
EUR 252
TGFA antibody
38131-100ul 100ul
EUR 252
TGFa protein
30R-3170 50 ug
EUR 257
Description: Purified recombinant TGFa protein
TGFA Antibody
DF6099 200ul
EUR 304
Description: TGFA Antibody detects endogenous levels of total TGFA.
TGFA Antibody
1-CSB-PA004275
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
TGFA Antibody
CSB-PA799735-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
TGFA Antibody
CSB-PA799735-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
TGFA Antibody
1-CSB-PA582653
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
TGFA Antibody
1-CSB-PA07294A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TGFA. Recognizes TGFA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
TGFA Conjugated Antibody
C35957 100ul
EUR 397
TGFA cloning plasmid
CSB-CL023445HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 480
  • Sequence: atggtcccctcggctggacagctcgccctgttcgctctgggtattgtgttggctgcgtgccaggccttggagaacagcacgtccccgctgagtgacccgcccgtggctgcagcagtggtgtcccattttaatgactgcccagattcccacactcagttctgcttccatggaacctg
  • Show more
Description: A cloning plasmid for the TGFA gene.
Rabbit TGFa Protein
20-abx069421
  • EUR 801.00
  • EUR 300.00
  • EUR 2513.00
  • EUR 954.00
  • EUR 565.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TGFA Rabbit pAb
A0337-100ul 100 ul
EUR 308
TGFA Rabbit pAb
A0337-200ul 200 ul
EUR 459
TGFA Rabbit pAb
A0337-20ul 20 ul
EUR 183
TGFA Rabbit pAb
A0337-50ul 50 ul
EUR 223
TGFA Rabbit pAb
A12516-100ul 100 ul
EUR 308
TGFA Rabbit pAb
A12516-200ul 200 ul
EUR 459
TGFA Rabbit pAb
A12516-20ul 20 ul
EUR 183
TGFA Rabbit pAb
A12516-50ul 50 ul
EUR 223
TGFA Rabbit pAb
A12522-100ul 100 ul
EUR 308
TGFA Rabbit pAb
A12522-200ul 200 ul
EUR 459
TGFA Rabbit pAb
A12522-20ul 20 ul
EUR 183
TGFA Rabbit pAb
A12522-50ul 50 ul
EUR 223
TGFA Polyclonal Antibody
A54053 100 µg
EUR 570.55
Description: reagents widely cited
TGFA Blocking Peptide
DF6099-BP 1mg
EUR 195
Anti-TGFA antibody
STJ29797 100 µl
EUR 277
Description: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-TGFA antibody
STJ114390 100 µl
EUR 277
Description: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-TGFA antibody
STJ114396 100 µl
EUR 277
Description: This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
TGFalpha(TGFA/1119) Antibody
BNC611119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF660R conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC611119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF660R conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC401119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF640R conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC401119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF640R conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC431119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF543 conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC431119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF543 conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC471119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF647 conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC471119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF647 conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC551119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF555 conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC551119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF555 conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC051119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF405M conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC051119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF405M conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC041119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF405S conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNC041119-500 500uL
EUR 544
Description: Primary antibody against TGFalpha(TGFA/1119), CF405S conjugate, Concentration: 0.1mg/mL
TGFalpha(TGFA/1119) Antibody
BNUB1119-100 100uL
EUR 209
Description: Primary antibody against TGFalpha(TGFA/1119), Concentration: 0.2mg/mL
TGFalpha(TGFA/1119) Antibody
BNUB1119-500 500uL
EUR 458
Description: Primary antibody against TGFalpha(TGFA/1119), Concentration: 0.2mg/mL
TGFalpha(TGFA/1119) Antibody
BNUM1119-50 50uL
EUR 395
Description: Primary antibody against TGFalpha(TGFA/1119), 1mg/mL
Rat TGFA shRNA Plasmid
20-abx984662
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TGFalpha(TGFA/1119) Antibody
BNC681119-100 100uL
EUR 199
Description: Primary antibody against TGFalpha(TGFA/1119), CF568 conjugate, Concentration: 0.1mg/mL