SEC24A Antibody
DF12315 200ul
EUR 304
Description: SEC24A antibody detects endogenous levels of SEC24A.
SEC24A Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC24A. Recognizes SEC24A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Mouse Protein transport protein Sec24A, Sec24a ELISA KIT
ELI-29750m 96 Tests
EUR 865
Human Protein transport protein Sec24A, SEC24A ELISA KIT
ELI-53195h 96 Tests
EUR 824
Bovine Protein transport protein Sec24A, SEC24A ELISA KIT
ELI-40854b 96 Tests
EUR 928
SEC24A Blocking Peptide
DF12315-BP 1mg
EUR 195
SEC24A cloning plasmid
CSB-CL020950HU-10ug 10ug
EUR 625
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1842
  • Sequence: atgtcccagccgggaataccggcctccggcggcgccccagccagcctccaggcccagaacggagccgccttggcctcggggtctccctacaccaacggtcctgtccaaaatgcattgctgtcttcacaagagtcagtgagccaaggatacaatttccagcttccaggatcctacc
  • Show more
Description: A cloning plasmid for the SEC24A gene.
anti- SEC24A antibody
FNab07681 100µg
EUR 548.75
  • Immunogen: SEC24 family, member A(S. cerevisiae)
  • Uniprot ID: O95486
  • Gene ID: 10802
  • Research Area: Metabolism
Description: Antibody raised against SEC24A
Anti-SEC24A antibody
PAab07681 100 ug
EUR 386
pOTB7-SEC24A Plasmid
PVTB00918 2 ug
EUR 356
Anti-SEC24A Antibody
STJ502894 100 µg
EUR 476
Anti-SEC24A (4D9)
YF-MA20500 100 ug
EUR 363
Description: Mouse monoclonal to SEC24A
EF002790 96 Tests
EUR 689
Mouse SEC24A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SEC24A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SEC24A Antibody BIOTIN
STJ502895 100 µg
EUR 586
Anti-SEC24A Antibody FITC
STJ502896 100 µg
EUR 586
Sec24a ORF Vector (Rat) (pORF)
ORF075966 1.0 ug DNA
EUR 506
SEC24A ORF Vector (Human) (pORF)
ORF009302 1.0 ug DNA
EUR 95
Sec24a ORF Vector (Mouse) (pORF)
ORF056857 1.0 ug DNA
EUR 506
Sec24a sgRNA CRISPR Lentivector set (Rat)
K6571501 3 x 1.0 ug
EUR 339
Sec24a sgRNA CRISPR Lentivector set (Mouse)
K4605501 3 x 1.0 ug
EUR 339
SEC24A sgRNA CRISPR Lentivector set (Human)
K2113501 3 x 1.0 ug
EUR 339
Sec24a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6571502 1.0 ug DNA
EUR 154
Sec24a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6571503 1.0 ug DNA
EUR 154
Sec24a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6571504 1.0 ug DNA
EUR 154
Sec24a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4605502 1.0 ug DNA
EUR 154
Sec24a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4605503 1.0 ug DNA
EUR 154
Sec24a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4605504 1.0 ug DNA
EUR 154
SEC24A sgRNA CRISPR Lentivector (Human) (Target 1)
K2113502 1.0 ug DNA
EUR 154
SEC24A sgRNA CRISPR Lentivector (Human) (Target 2)
K2113503 1.0 ug DNA
EUR 154
SEC24A sgRNA CRISPR Lentivector (Human) (Target 3)
K2113504 1.0 ug DNA
EUR 154
SEC24A Protein Vector (Rat) (pPB-C-His)
PV303862 500 ng
EUR 1191
SEC24A Protein Vector (Rat) (pPB-N-His)
PV303863 500 ng
EUR 1191
SEC24A Protein Vector (Rat) (pPM-C-HA)
PV303864 500 ng
EUR 1191
SEC24A Protein Vector (Rat) (pPM-C-His)
PV303865 500 ng
EUR 1191
SEC24A Protein Vector (Mouse) (pPB-C-His)
PV227426 500 ng
EUR 1065
SEC24A Protein Vector (Mouse) (pPB-N-His)
PV227427 500 ng
EUR 1065
SEC24A Protein Vector (Mouse) (pPM-C-HA)
PV227428 500 ng
EUR 1065
SEC24A Protein Vector (Mouse) (pPM-C-His)
PV227429 500 ng
EUR 1065
SEC24A Protein Vector (Human) (pPB-C-His)
PV037205 500 ng
EUR 329
SEC24A Protein Vector (Human) (pPB-N-His)
PV037206 500 ng
EUR 329
SEC24A Protein Vector (Human) (pPM-C-HA)
PV037207 500 ng
EUR 329
SEC24A Protein Vector (Human) (pPM-C-His)
PV037208 500 ng
EUR 329
Sec24a 3'UTR Luciferase Stable Cell Line
TU118500 1.0 ml Ask for price
Sec24a 3'UTR GFP Stable Cell Line
TU168500 1.0 ml Ask for price
Sec24a 3'UTR Luciferase Stable Cell Line
TU220062 1.0 ml Ask for price
Sec24a 3'UTR GFP Stable Cell Line
TU270062 1.0 ml Ask for price
SEC24A 3'UTR GFP Stable Cell Line
TU072838 1.0 ml
EUR 1521
SEC24A 3'UTR Luciferase Stable Cell Line
TU022838 1.0 ml
EUR 1521
Human SEC24 Family Member A (SEC24A) ELISA Kit
abx383087-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SEC24 Homolog A, COPII Coat Complex Component (SEC24A) Antibody
abx237681-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6571505 3 x 1.0 ug
EUR 376
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4605505 3 x 1.0 ug
EUR 376
SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2113505 3 x 1.0 ug
EUR 376
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6571506 1.0 ug DNA
EUR 167
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6571507 1.0 ug DNA
EUR 167
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6571508 1.0 ug DNA
EUR 167
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4605506 1.0 ug DNA
EUR 167
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4605507 1.0 ug DNA
EUR 167
Sec24a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4605508 1.0 ug DNA
EUR 167
SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2113506 1.0 ug DNA
EUR 167
SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2113507 1.0 ug DNA
EUR 167
SEC24A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2113508 1.0 ug DNA
EUR 167