Human Ribophorin I (RPN1) ELISA Kit

DLR-RPN1-Hu-96T 96T
EUR 673
  • Should the Human Ribophorin I (RPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribophorin I (RPN1) in samples from tissue homogenates or other biological fluids.

Human Ribophorin I (RPN1) ELISA Kit

RD-RPN1-Hu-48Tests 48 Tests
EUR 521

Human Ribophorin I (RPN1) ELISA Kit

RD-RPN1-Hu-96Tests 96 Tests
EUR 723

Human Ribophorin I (RPN1) ELISA Kit

RDR-RPN1-Hu-48Tests 48 Tests
EUR 544

Human Ribophorin I (RPN1) ELISA Kit

RDR-RPN1-Hu-96Tests 96 Tests
EUR 756

Rpn1/ Rat Rpn1 ELISA Kit

ELI-15193r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPN1 Antibody

36173-100ul 100ul
EUR 252

RPN1 antibody

39133-100ul 100ul
EUR 252

RPN1 antibody

10R-5666 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5667 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5668 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5669 100 ul
EUR 726
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5670 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5671 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5672 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5673 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

10R-5674 100 ul
EUR 691
Description: Mouse monoclonal RPN1 antibody

RPN1 antibody

70R-19993 50 ul
EUR 435
Description: Rabbit polyclonal RPN1 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPN1 Antibody

DF12727 200ul
EUR 304
Description: RPN1 Antibody detects endogenous levels of RPN1.

RPN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RPN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RPN1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPN1 Conjugated Antibody

C39133 100ul
EUR 397

RPN1 Conjugated Antibody

C36173 100ul
EUR 397

RPN1 cloning plasmid

CSB-CL020344HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1824
  • Sequence: atggaggcgccagccgccggcttgtttctgctcctgttgcttgggacttgggccccggcgccgggcagcgcctcctccgaggcaccgccgctgatcaatgaggacgtgaagcgcacagtggacctaagcagccacctggctaaggtgacggccgaggtggtcctggcgcacctgg
  • Show more
Description: A cloning plasmid for the RPN1 gene.

anti- RPN1 antibody

FNab07450 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ribophorin I
  • Uniprot ID: P04843
  • Gene ID: 6184
  • Research Area: Metabolism
Description: Antibody raised against RPN1

RPN1 Rabbit pAb

A12497-100ul 100 ul
EUR 308

RPN1 Rabbit pAb

A12497-200ul 200 ul
EUR 459

RPN1 Rabbit pAb

A12497-20ul 20 ul
EUR 183

RPN1 Rabbit pAb

A12497-50ul 50 ul
EUR 223

RPN1 Polyclonal Antibody

A54001 100 µg
EUR 570.55
Description: fast delivery possible

RPN1 Rabbit pAb

A6726-100ul 100 ul
EUR 308

RPN1 Rabbit pAb

A6726-200ul 200 ul
EUR 459

RPN1 Rabbit pAb

A6726-20ul 20 ul
EUR 183

RPN1 Rabbit pAb

A6726-50ul 50 ul
EUR 223

RPN1 Blocking Peptide

DF12727-BP 1mg
EUR 195

Anti-RPN1 antibody

PAab07450 100 ug
EUR 386

pDONR223-RPN1 Plasmid

PVTB01119-1 2 ug
EUR 356

Anti-RPN1 antibody

STJ28809 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

Anti-RPN1 antibody

STJ114371 100 µl
EUR 277
Description: This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome.

Mouse RPN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002608 96 Tests
EUR 689


ELI-36305h 96 Tests
EUR 824

Mouse Rpn1 ELISA KIT

ELI-30183m 96 Tests
EUR 865


ELI-40915c 96 Tests
EUR 928

Ribophorin I (RPN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin 1 (RPN1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ribophorin I (RPN1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribophorin I (RPN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribophorin I (RPN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human RPN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPN1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPN1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPN1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPN1. Recognizes RPN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ribophorin I expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04843
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.3kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Recombinant Ribophorin I (RPN1) expressed in: E.coli

Recombinant Ribophorin I (RPN1)

  • EUR 533.66
  • EUR 246.00
  • EUR 1726.24
  • EUR 642.08
  • EUR 1184.16
  • EUR 420.00
  • EUR 4165.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91YQ5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.4kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Ribophorin I expressed in: E.coli

RPN1 Recombinant Protein (Human)

RP027055 100 ug Ask for price

RPN1 Recombinant Protein (Rat)

RP226742 100 ug Ask for price

RPN1 Recombinant Protein (Mouse)

RP169139 100 ug Ask for price

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Ribophorin I (RPN1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Ribophorin I (RPN1) Protein

  • EUR 746.00
  • EUR 300.00
  • EUR 2318.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Ribophorin I (RPN1) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ribophorin I (RPN1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

RPN1 Polyclonal Antibody, HRP Conjugated

A54002 100 µg
EUR 570.55
Description: reagents widely cited

RPN1 Polyclonal Antibody, FITC Conjugated

A54003 100 µg
EUR 570.55
Description: Ask the seller for details

RPN1 Polyclonal Antibody, Biotin Conjugated

A54004 100 µg
EUR 570.55
Description: The best epigenetics products

RPN1 ORF Vector (Human) (pORF)

ORF009019 1.0 ug DNA
EUR 95

Rpn1 ORF Vector (Mouse) (pORF)

ORF056381 1.0 ug DNA
EUR 506