RGS7

RGS7 antibody

70R-19879 50 ul
EUR 435
Description: Rabbit polyclonal RGS7 antibody

RGS7 antibody

39128-100ul 100ul
EUR 252

RGS7 Antibody

DF4418 200ul
EUR 304
Description: RGS7 Antibody detects endogenous levels of total RGS7.

RGS7 Antibody

1-CSB-PA040213
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RGS7 Antibody

1-CSB-PA019659ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RGS7 Antibody

1-CSB-PA019659GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RGS7 Antibody

1-CSB-PA019659LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RGS7 siRNA

20-abx904557
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS7 siRNA

20-abx931423
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS7 siRNA

20-abx931424
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS7 Antibody

ABD4418 100 ug
EUR 438

pBlueScriptR-RGS7

PVT17316 2 ug
EUR 231

anti-RGS7

YF-PA14381 50 ul
EUR 363
Description: Mouse polyclonal to RGS7

anti-RGS7

YF-PA14382 50 ug
EUR 363
Description: Mouse polyclonal to RGS7

RGS7 Blocking Peptide

33R-5725 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS7 antibody, catalog no. 20R-1256

RGS7 Blocking Peptide

DF4418-BP 1mg
EUR 195

Anti-RGS7 Antibody

A04305 100ul
EUR 397
Description: Rabbit Polyclonal RGS7 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RGS7 Conjugated Antibody

C39128 100ul
EUR 397

RGS7 cloning plasmid

CSB-CL019659HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1464
  • Sequence: atggcccaggggaataattatgggcagaccagcaacggggtggccgatgaatcacccaacatgctggtgtacagaaagatggaagacgtcatagcacggatgcaagatgaaaaaaatggaattcctattcgtacggtcaaaagctttctttccaagatacctagcgtcttctctg
  • Show more
Description: A cloning plasmid for the RGS7 gene.

RGS7 Rabbit pAb

A6720-100ul 100 ul
EUR 308

RGS7 Rabbit pAb

A6720-200ul 200 ul
EUR 459

RGS7 Rabbit pAb

A6720-20ul 20 ul
EUR 183

RGS7 Rabbit pAb

A6720-50ul 50 ul
EUR 223

RGS7 Polyclonal Antibody

A60598 100 µg
EUR 570.55
Description: The best epigenetics products

RGS7 Polyclonal Antibody

ABP56043-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RGS7 from Human, Mouse, Rat. This RGS7 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210

RGS7 Polyclonal Antibody

ABP56043-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RGS7 from Human, Mouse, Rat. This RGS7 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210

RGS7 Polyclonal Antibody

ABP56043-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RGS7 from Human, Mouse, Rat. This RGS7 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210

anti- RGS7 antibody

FNab07273 100µg
EUR 548.75
  • Immunogen: regulator of G-protein signaling 7
  • Uniprot ID: P49802
  • Gene ID: 6000
  • Research Area: Signal Transduction
Description: Antibody raised against RGS7

RGS7 Polyclonal Antibody

ES7042-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGS7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS7 Polyclonal Antibody

ES7042-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RGS7 antibody

PAab07273 100 ug
EUR 386

Anti-RGS7 antibody

STJ28803 100 µl
EUR 277

Anti-RGS7 antibody

STJ95441 200 µl
EUR 197
Description: Rabbit polyclonal to RGS7.

RGS7 ELISA KIT|Human

EF002442 96 Tests
EUR 689

Mouse RGS7 shRNA Plasmid

20-abx973604
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RGS7 shRNA Plasmid

20-abx985826
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS7 Antibody, HRP conjugated

1-CSB-PA019659LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGS7 Antibody, FITC conjugated

1-CSB-PA019659LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGS7 Antibody, Biotin conjugated

1-CSB-PA019659LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RGS7 shRNA Plasmid

20-abx954068
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RGS7 Recombinant Protein (Human)

RP026341 100 ug Ask for price

RGS7 Recombinant Protein (Mouse)

RP167924 100 ug Ask for price

RGS7 Recombinant Protein (Mouse)

RP167927 100 ug Ask for price

RGS7 Recombinant Protein (Rat)

RP225965 100 ug Ask for price

Polyclonal RGS7 Antibody (C-term)

AMM07601G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS7 (C-term). This antibody is tested and proven to work in the following applications:

RGS7 Polyclonal Antibody, Biotin Conjugated

A60599 100 µg
EUR 570.55
Description: kits suitable for this type of research

RGS7 Polyclonal Antibody, FITC Conjugated

A60600 100 µg
EUR 570.55
Description: fast delivery possible

RGS7 Polyclonal Antibody, HRP Conjugated

A60601 100 µg
EUR 570.55
Description: reagents widely cited

Rgs7 ORF Vector (Rat) (pORF)

ORF075323 1.0 ug DNA
EUR 506

RGS7 ORF Vector (Human) (pORF)

ORF008781 1.0 ug DNA
EUR 95

Rgs7 ORF Vector (Mouse) (pORF)

ORF055976 1.0 ug DNA
EUR 506

Rgs7 ORF Vector (Mouse) (pORF)

ORF055977 1.0 ug DNA
EUR 506

RGS7 ELISA Kit (Human) (OKCD08519)

OKCD08519 96 Wells
EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

Rgs7 sgRNA CRISPR Lentivector set (Rat)

K6871501 3 x 1.0 ug
EUR 339

RGS7 sgRNA CRISPR Lentivector set (Human)

K1817201 3 x 1.0 ug
EUR 339

Rgs7 sgRNA CRISPR Lentivector set (Mouse)

K3813601 3 x 1.0 ug
EUR 339

Rgs7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6871502 1.0 ug DNA
EUR 154

Rgs7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6871503 1.0 ug DNA
EUR 154

Rgs7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6871504 1.0 ug DNA
EUR 154

RGS7 sgRNA CRISPR Lentivector (Human) (Target 1)

K1817202 1.0 ug DNA
EUR 154

RGS7 sgRNA CRISPR Lentivector (Human) (Target 2)

K1817203 1.0 ug DNA
EUR 154

RGS7 sgRNA CRISPR Lentivector (Human) (Target 3)

K1817204 1.0 ug DNA
EUR 154

Rgs7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3813602 1.0 ug DNA
EUR 154

Rgs7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3813603 1.0 ug DNA
EUR 154

Rgs7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3813604 1.0 ug DNA
EUR 154

RGS7 Protein Vector (Rat) (pPB-C-His)

PV301290 500 ng
EUR 603

RGS7 Protein Vector (Rat) (pPB-N-His)

PV301291 500 ng
EUR 603

RGS7 Protein Vector (Rat) (pPM-C-HA)

PV301292 500 ng
EUR 603

RGS7 Protein Vector (Rat) (pPM-C-His)

PV301293 500 ng
EUR 603

RGS7 Protein Vector (Human) (pPB-C-His)

PV035121 500 ng
EUR 329

RGS7 Protein Vector (Human) (pPB-N-His)

PV035122 500 ng
EUR 329

RGS7 Protein Vector (Human) (pPM-C-HA)

PV035123 500 ng
EUR 329

RGS7 Protein Vector (Human) (pPM-C-His)

PV035124 500 ng
EUR 329

RGS7 Protein Vector (Mouse) (pPB-C-His)

PV223902 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPB-N-His)

PV223903 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-HA)

PV223904 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-His)

PV223905 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPB-C-His)

PV223906 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPB-N-His)

PV223907 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-HA)

PV223908 500 ng
EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-His)

PV223909 500 ng
EUR 603

Rgs7 3'UTR Luciferase Stable Cell Line

TU117806 1.0 ml Ask for price

Rgs7 3'UTR GFP Stable Cell Line

TU167806 1.0 ml Ask for price

Rgs7 3'UTR Luciferase Stable Cell Line

TU219381 1.0 ml Ask for price

Rgs7 3'UTR GFP Stable Cell Line

TU269381 1.0 ml Ask for price