RGS7

RGS7 siRNA
20-abx931423	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RGS7 siRNA
20-abx931424	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RGS7 Antibody
ABD4418	Lifescience Market	100 ug	EUR 438

RGS7 antibody
39128-100ul	SAB	100ul	EUR 252

RGS7 antibody
20R-1256	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RGS7 antibody

RGS7 antibody
70R-19879	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RGS7 antibody

RGS7 Antibody
DF4418	Affbiotech	200ul	EUR 304
Description: RGS7 Antibody detects endogenous levels of total RGS7.

RGS7 Antibody
1-CSB-PA040213	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RGS7 Antibody
1-CSB-PA019659ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RGS7 Antibody
1-CSB-PA019659GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RGS7 Antibody
1-CSB-PA019659LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

pBlueScriptR-RGS7
PVT17316	Lifescience Market	2 ug	EUR 231

anti-RGS7
YF-PA14381	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to RGS7

anti-RGS7
YF-PA14382	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RGS7

RGS7 Conjugated Antibody
C39128	SAB	100ul	EUR 397

RGS7 cloning plasmid
CSB-CL019659HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1464 Sequence: atggcccaggggaataattatgggcagaccagcaacggggtggccgatgaatcacccaacatgctggtgtacagaaagatggaagacgtcatagcacggatgcaagatgaaaaaaatggaattcctattcgtacggtcaaaagctttctttccaagatacctagcgtcttctctg Show more
Description: A cloning plasmid for the RGS7 gene.

RGS7 Polyclonal Antibody
ES7042-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RGS7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS7 Polyclonal Antibody
ES7042-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RGS7 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- RGS7 antibody
FNab07273	FN Test	100µg	EUR 548.75
Immunogen: regulator of G-protein signaling 7 Uniprot ID: P49802 Gene ID: 6000 Research Area: Signal Transduction
Description: Antibody raised against RGS7

RGS7 Polyclonal Antibody
ABP56043-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of RGS7 from Human, Mouse, Rat. This RGS7 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210

RGS7 Polyclonal Antibody
ABP56043-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of RGS7 from Human, Mouse, Rat. This RGS7 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210

RGS7 Polyclonal Antibody
ABP56043-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210 Applications tips:
Description: A polyclonal antibody for detection of RGS7 from Human, Mouse, Rat. This RGS7 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human RGS7 at AA range: 130-210

Anti-RGS7 Antibody
A04305	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RGS7 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RGS7 Polyclonal Antibody
A60598	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RGS7 Rabbit pAb
A6720-100ul	Abclonal	100 ul	EUR 308

RGS7 Rabbit pAb
A6720-200ul	Abclonal	200 ul	EUR 459

RGS7 Rabbit pAb
A6720-20ul	Abclonal	20 ul	EUR 183

RGS7 Rabbit pAb
A6720-50ul	Abclonal	50 ul	EUR 223

RGS7 Blocking Peptide
33R-5725	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS7 antibody, catalog no. 20R-1256

RGS7 Blocking Peptide
DF4418-BP	Affbiotech	1mg	EUR 195

Anti-RGS7 antibody
PAab07273	Lifescience Market	100 ug	EUR 386

Anti-RGS7 antibody
STJ95441	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to RGS7.

Anti-RGS7 antibody
STJ28803	St John's Laboratory	100 µl	EUR 277

Mouse RGS7 shRNA Plasmid
20-abx973604	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RGS7 shRNA Plasmid
20-abx985826	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RGS7 ELISA KIT|Human
EF002442	Lifescience Market	96 Tests	EUR 689

Human RGS7 shRNA Plasmid
20-abx954068	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RGS7 Antibody, HRP conjugated
1-CSB-PA019659LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGS7 Antibody, FITC conjugated
1-CSB-PA019659LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGS7 Antibody, Biotin conjugated
1-CSB-PA019659LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS7. Recognizes RGS7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGS7 Recombinant Protein (Human)
RP026341	ABM	100 ug	Ask for price

RGS7 Recombinant Protein (Rat)
RP225965	ABM	100 ug	Ask for price

RGS7 Recombinant Protein (Mouse)
RP167924	ABM	100 ug	Ask for price

RGS7 Recombinant Protein (Mouse)
RP167927	ABM	100 ug	Ask for price

Polyclonal RGS7 Antibody (C-term)
AMM07601G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS7 (C-term). This antibody is tested and proven to work in the following applications:

RGS7 Polyclonal Antibody, Biotin Conjugated
A60599	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RGS7 Polyclonal Antibody, FITC Conjugated
A60600	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RGS7 Polyclonal Antibody, HRP Conjugated
A60601	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RGS7 ORF Vector (Human) (pORF)
ORF008781	ABM	1.0 ug DNA	EUR 95

Rgs7 ORF Vector (Mouse) (pORF)
ORF055976	ABM	1.0 ug DNA	EUR 506

Rgs7 ORF Vector (Mouse) (pORF)
ORF055977	ABM	1.0 ug DNA	EUR 506

Rgs7 ORF Vector (Rat) (pORF)
ORF075323	ABM	1.0 ug DNA	EUR 506

RGS7 ELISA Kit (Human) (OKCD08519)
OKCD08519	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab);Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

RGS7 sgRNA CRISPR Lentivector set (Human)
K1817201	ABM	3 x 1.0 ug	EUR 339

Rgs7 sgRNA CRISPR Lentivector set (Mouse)
K3813601	ABM	3 x 1.0 ug	EUR 339

Rgs7 sgRNA CRISPR Lentivector set (Rat)
K6871501	ABM	3 x 1.0 ug	EUR 339

RGS7 sgRNA CRISPR Lentivector (Human) (Target 1)
K1817202	ABM	1.0 ug DNA	EUR 154

RGS7 sgRNA CRISPR Lentivector (Human) (Target 2)
K1817203	ABM	1.0 ug DNA	EUR 154

RGS7 sgRNA CRISPR Lentivector (Human) (Target 3)
K1817204	ABM	1.0 ug DNA	EUR 154

Rgs7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3813602	ABM	1.0 ug DNA	EUR 154

Rgs7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3813603	ABM	1.0 ug DNA	EUR 154

Rgs7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3813604	ABM	1.0 ug DNA	EUR 154

Rgs7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6871502	ABM	1.0 ug DNA	EUR 154

Rgs7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6871503	ABM	1.0 ug DNA	EUR 154

Rgs7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6871504	ABM	1.0 ug DNA	EUR 154

RGS7 Protein Vector (Human) (pPB-C-His)
PV035121	ABM	500 ng	EUR 329

RGS7 Protein Vector (Human) (pPB-N-His)
PV035122	ABM	500 ng	EUR 329

RGS7 Protein Vector (Human) (pPM-C-HA)
PV035123	ABM	500 ng	EUR 329

RGS7 Protein Vector (Human) (pPM-C-His)
PV035124	ABM	500 ng	EUR 329

RGS7 Protein Vector (Rat) (pPB-C-His)
PV301290	ABM	500 ng	EUR 603

RGS7 Protein Vector (Rat) (pPB-N-His)
PV301291	ABM	500 ng	EUR 603

RGS7 Protein Vector (Rat) (pPM-C-HA)
PV301292	ABM	500 ng	EUR 603

RGS7 Protein Vector (Rat) (pPM-C-His)
PV301293	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPB-C-His)
PV223902	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPB-N-His)
PV223903	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-HA)
PV223904	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-His)
PV223905	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPB-C-His)
PV223906	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPB-N-His)
PV223907	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-HA)
PV223908	ABM	500 ng	EUR 603

RGS7 Protein Vector (Mouse) (pPM-C-His)
PV223909	ABM	500 ng	EUR 603

Rgs7 3'UTR GFP Stable Cell Line
TU167806	ABM	1.0 ml	Ask for price

RGS7 3'UTR Luciferase Stable Cell Line
TU019842	ABM	1.0 ml	EUR 1394

Rgs7 3'UTR Luciferase Stable Cell Line
TU117806	ABM	1.0 ml	Ask for price

RGS7 3'UTR GFP Stable Cell Line
TU069842	ABM	1.0 ml	EUR 1394