PMM1

PMM1 siRNA
20-abx929042	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PMM1 antibody
70R-3894	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PMM1 antibody raised against the N terminal of PMM1

PMM1 antibody
70R-19367	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PMM1 antibody

PMM1 Antibody
1-CSB-PA018237GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PMM1 Antibody
1-CSB-PA018237LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

pENTR223-PMM1
PVT12669	Lifescience Market	2 ug	EUR 391

PMM1 cloning plasmid
CSB-CL018237HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 789 Sequence: atggcagtcaccgcccaggcagcccgcaggaaggagcgcgtcctctgcctgtttgacgtggacgggaccctcacgccggctcgccagaaaattgaccctgaggtggccgccttcctgcagaagctacgaagtagagtgcagatcggtgtggtgggcggctctgactactgtaagat Show more
Description: A cloning plasmid for the PMM1 gene.

anti- PMM1 antibody
FNab06573	FN Test	100µg	EUR 548.75
Immunogen: phosphomannomutase 1 Uniprot ID: Q92871 Gene ID: 5372 Research Area: Metabolism
Description: Antibody raised against PMM1

PMM1 Polyclonal Antibody
A50416	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PMM1 Blocking Peptide
33R-5802	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PMM1 antibody, catalog no. 70R-3894

Anti-PMM1 antibody
PAab06573	Lifescience Market	100 ug	EUR 386

Mouse PMM1 shRNA Plasmid
20-abx973995	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PMM1 ELISA KIT|Human
EF001885	Lifescience Market	96 Tests	EUR 689

Phosphomannomutase 1 (PMM1) Antibody
20-abx114494	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody
20-abx131573	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Phosphomannomutase 1 (PMM1) Antibody
abx122637-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody
20-abx318357	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody
abx236573-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human PMM1 shRNA Plasmid
20-abx953607	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PMM1 protein (His tag)
80R-1543	Fitzgerald	50 ug	EUR 305
Description: Purified recombinant Human PMM1 protein

PMM1 Antibody, HRP conjugated
1-CSB-PA018237LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PMM1 Antibody, FITC conjugated
1-CSB-PA018237LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PMM1 Antibody, Biotin conjugated
1-CSB-PA018237LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant Phosphomannomutase 1 (PMM1)
4-RPC729Hu01	Cloud-Clone	EUR 463.78 EUR 227.00 EUR 1464.16 EUR 554.72 EUR 1009.44 EUR 373.00 EUR 3510.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q92871 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.3kDa Isoelectric Point: Inquire
Description: Recombinant Human Phosphomannomutase 1 expressed in: E.coli

PMM1 Recombinant Protein (Human)
RP023896	ABM	100 ug	Ask for price

PMM1 Recombinant Protein (Rat)
RP221123	ABM	100 ug	Ask for price

PMM1 Recombinant Protein (Mouse)
RP163073	ABM	100 ug	Ask for price

Human Phosphomannomutase 1 (PMM1) Protein
20-abx650148	Abbexa	EUR 648.00 EUR 272.00 EUR 1970.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Phosphomannomutase 1 (PMM1) Antibody (HRP)
20-abx304857	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody (FITC)
20-abx304858	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody (Biotin)
20-abx304859	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PMM1 Polyclonal Antibody, HRP Conjugated
A50417	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PMM1 Polyclonal Antibody, FITC Conjugated
A50418	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

PMM1 Polyclonal Antibody, Biotin Conjugated
A50419	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PMM1 ORF Vector (Human) (pORF)
ORF007966	ABM	1.0 ug DNA	EUR 95

Pmm1 ORF Vector (Rat) (pORF)
ORF073709	ABM	1.0 ug DNA	EUR 506

Pmm1 ORF Vector (Mouse) (pORF)
ORF054359	ABM	1.0 ug DNA	EUR 506

Mouse Phosphomannomutase 1, Pmm1 ELISA KIT
ELI-22965m	Lifescience Market	96 Tests	EUR 865

Human Phosphomannomutase 1, PMM1 ELISA KIT
ELI-45540h	Lifescience Market	96 Tests	EUR 824

Human Phosphomannomutase 1 (PMM1) ELISA Kit
abx382313-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PMM1 sgRNA CRISPR Lentivector set (Human)
K1673501	ABM	3 x 1.0 ug	EUR 339

Pmm1 sgRNA CRISPR Lentivector set (Mouse)
K4913601	ABM	3 x 1.0 ug	EUR 339

Pmm1 sgRNA CRISPR Lentivector set (Rat)
K7158801	ABM	3 x 1.0 ug	EUR 339

Phosphomannomutase 1 (PMM1) Polyclonal Antibody (Human)
4-PAC729Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PMM1 (Ala2~Ala262) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phosphomannomutase 1 (PMM1)

PMM1 Phosphomannomutase 1 Human Recombinant Protein
PROTQ92871	BosterBio	Regular: 10ug	EUR 317
Description: PMM1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 282 amino acids (1-262 a.a.) and having a molecular mass of 31.9kDa. The PMM1 is purified by proprietary chromatographic techniques.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)
C249-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)
C249-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)
C249-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)
C249-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

PMM1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1673502	ABM	1.0 ug DNA	EUR 154

PMM1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1673503	ABM	1.0 ug DNA	EUR 154

PMM1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1673504	ABM	1.0 ug DNA	EUR 154

Pmm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4913602	ABM	1.0 ug DNA	EUR 154

Pmm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4913603	ABM	1.0 ug DNA	EUR 154

Pmm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4913604	ABM	1.0 ug DNA	EUR 154