PMM1

PMM1 Antibody

1-CSB-PA018237GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PMM1 Antibody

1-CSB-PA018237LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PMM1 antibody

70R-3894 50 ug
EUR 467
Description: Rabbit polyclonal PMM1 antibody raised against the N terminal of PMM1

PMM1 siRNA

20-abx929041
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PMM1 siRNA

20-abx929042
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-PMM1

PVT12669 2 ug
EUR 391

PMM1 Blocking Peptide

33R-5802 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PMM1 antibody, catalog no. 70R-3894

PMM1 cloning plasmid

CSB-CL018237HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atggcagtcaccgcccaggcagcccgcaggaaggagcgcgtcctctgcctgtttgacgtggacgggaccctcacgccggctcgccagaaaattgaccctgaggtggccgccttcctgcagaagctacgaagtagagtgcagatcggtgtggtgggcggctctgactactgtaagat
  • Show more
Description: A cloning plasmid for the PMM1 gene.

PMM1 Polyclonal Antibody

A50416 100 µg
EUR 570.55
Description: The best epigenetics products

anti- PMM1 antibody

FNab06573 100µg
EUR 548.75
  • Immunogen: phosphomannomutase 1
  • Uniprot ID: Q92871
  • Gene ID: 5372
  • Research Area: Metabolism
Description: Antibody raised against PMM1

Anti-PMM1 antibody

PAab06573 100 ug
EUR 386

PMM1 Antibody, HRP conjugated

1-CSB-PA018237LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PMM1 Antibody, FITC conjugated

1-CSB-PA018237LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PMM1 Antibody, Biotin conjugated

1-CSB-PA018237LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PMM1. Recognizes PMM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PMM1 protein (His tag)

80R-1543 50 ug
EUR 305
Description: Purified recombinant Human PMM1 protein

Phosphomannomutase 1 (PMM1) Antibody

20-abx114494
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody

20-abx131573
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phosphomannomutase 1 (PMM1) Antibody

abx122637-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

PMM1 ELISA KIT|Human

EF001885 96 Tests
EUR 689

Mouse PMM1 shRNA Plasmid

20-abx973995
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phosphomannomutase 1 (PMM1) Antibody

abx236573-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Phosphomannomutase 1 (PMM1) Antibody

20-abx318357
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human PMM1 shRNA Plasmid

20-abx953607
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Phosphomannomutase 1 (PMM1)

4-RPC729Hu01
  • EUR 463.78
  • EUR 227.00
  • EUR 1464.16
  • EUR 554.72
  • EUR 1009.44
  • EUR 373.00
  • EUR 3510.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92871
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Phosphomannomutase 1 expressed in: E.coli

PMM1 Recombinant Protein (Human)

RP023896 100 ug Ask for price

PMM1 Recombinant Protein (Mouse)

RP163073 100 ug Ask for price

PMM1 Recombinant Protein (Rat)

RP221123 100 ug Ask for price

Human Phosphomannomutase 1 (PMM1) Protein

20-abx650148
  • EUR 648.00
  • EUR 272.00
  • EUR 1970.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phosphomannomutase 1 (PMM1) Antibody (HRP)

20-abx304857
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody (FITC)

20-abx304858
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphomannomutase 1 (PMM1) Antibody (Biotin)

20-abx304859
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PMM1 Polyclonal Antibody, HRP Conjugated

A50417 100 µg
EUR 570.55
Description: kits suitable for this type of research

PMM1 Polyclonal Antibody, FITC Conjugated

A50418 100 µg
EUR 570.55
Description: fast delivery possible

PMM1 Polyclonal Antibody, Biotin Conjugated

A50419 100 µg
EUR 570.55
Description: reagents widely cited

Pmm1 ORF Vector (Rat) (pORF)

ORF073709 1.0 ug DNA
EUR 506

PMM1 ORF Vector (Human) (pORF)

ORF007966 1.0 ug DNA
EUR 95

Pmm1 ORF Vector (Mouse) (pORF)

ORF054359 1.0 ug DNA
EUR 506

Mouse Phosphomannomutase 1, Pmm1 ELISA KIT

ELI-22965m 96 Tests
EUR 865

Human Phosphomannomutase 1, PMM1 ELISA KIT

ELI-45540h 96 Tests
EUR 824

Human Phosphomannomutase 1 (PMM1) ELISA Kit

abx382313-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pmm1 sgRNA CRISPR Lentivector set (Mouse)

K4913601 3 x 1.0 ug
EUR 339

Pmm1 sgRNA CRISPR Lentivector set (Rat)

K7158801 3 x 1.0 ug
EUR 339

PMM1 sgRNA CRISPR Lentivector set (Human)

K1673501 3 x 1.0 ug
EUR 339

Phosphomannomutase 1 (PMM1) Polyclonal Antibody (Human)

4-PAC729Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PMM1 (Ala2~Ala262)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phosphomannomutase 1 (PMM1)

PMM1 Phosphomannomutase 1 Human Recombinant Protein

PROTQ92871 Regular: 10ug
EUR 317
Description: PMM1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 282 amino acids (1-262 a.a.) and having a molecular mass of 31.9kDa. The PMM1 is purified by proprietary chromatographic techniques.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)

C249-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)

C249-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)

C249-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Recombinant Human Phosphomannomutase 1/PMM1 (C-6His)

C249-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 1mM DTT, pH 8.0.

Pmm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4913602 1.0 ug DNA
EUR 154

Pmm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4913603 1.0 ug DNA
EUR 154

Pmm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4913604 1.0 ug DNA
EUR 154

Pmm1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7158802 1.0 ug DNA
EUR 154

Pmm1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7158803 1.0 ug DNA
EUR 154

Pmm1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7158804 1.0 ug DNA
EUR 154