NUP43

Nucleoporin Nup43 (NUP43) Antibody

abx029454-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleoporin Nup43 (NUP43) Antibody

abx029454-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleoporin Nup43 (NUP43) Antibody

20-abx309716
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Nucleoporin Nup43, Nup43 ELISA KIT

ELI-44512m 96 Tests
EUR 865

Human Nucleoporin Nup43, NUP43 ELISA KIT

ELI-36777h 96 Tests
EUR 824

NUP43 antibody

70R-2178 50 ug
EUR 467
Description: Rabbit polyclonal NUP43 antibody raised against the middle region of NUP43

NUP43 Antibody

1-CSB-PA844045LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP43. Recognizes NUP43 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NUP43 siRNA

20-abx926636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP43 siRNA

20-abx926637
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NUP43

YF-PA23024 50 ug
EUR 363
Description: Mouse polyclonal to NUP43

NUP43 Polyclonal Antibody

29527-100ul 100ul
EUR 252

NUP43 Polyclonal Antibody

29527-50ul 50ul
EUR 187

NUP43 Rabbit pAb

A15983-100ul 100 ul
EUR 308

NUP43 Rabbit pAb

A15983-200ul 200 ul
EUR 459

NUP43 Rabbit pAb

A15983-20ul 20 ul
EUR 183

NUP43 Rabbit pAb

A15983-50ul 50 ul
EUR 223

NUP43 Blocking Peptide

33R-3830 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP43 antibody, catalog no. 70R-2178

NUP43 Antibody (HRP)

20-abx309717
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUP43 Antibody (FITC)

20-abx309718
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUP43 Antibody (Biotin)

20-abx309719
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUP43 cloning plasmid

CSB-CL844045HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1143
  • Sequence: atggaggaaatttatgcgaagtttgtgtcccagaaaatcagcaaaacccgctggcgaccgctgcctccgggaagtttacagaccgcggagacgttcgctacaggatcttgggacaatgaggaaaattatatttcactgtggtctattggagattttggaaacttggactctgatg
  • Show more
Description: A cloning plasmid for the NUP43 gene.

NUP43 Polyclonal Antibody

A66774 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-NUP43 antibody

STJ118442 100 µl
EUR 277

Anti-NUP43 (2G5)

YF-MA20123 100 ug
EUR 363
Description: Mouse monoclonal to NUP43

NUP43 Antibody, HRP conjugated

1-CSB-PA844045LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP43. Recognizes NUP43 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP43 Antibody, FITC conjugated

1-CSB-PA844045LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP43. Recognizes NUP43 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP43 Antibody, Biotin conjugated

1-CSB-PA844045LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP43. Recognizes NUP43 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse NUP43 shRNA Plasmid

20-abx977088
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUP43 Polyclonal Conjugated Antibody

C29527 100ul
EUR 397

Human NUP43 shRNA Plasmid

20-abx967545
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NUP43 Recombinant Protein (Human)

RP021916 100 ug Ask for price

NUP43 Recombinant Protein (Mouse)

RP155498 100 ug Ask for price

NUP43 Recombinant Protein (Rat)

RP214862 100 ug Ask for price

NUP43 Polyclonal Antibody, HRP Conjugated

A66775 100 µg
EUR 570.55
Description: The best epigenetics products

NUP43 Polyclonal Antibody, FITC Conjugated

A66776 100 µg
EUR 570.55
Description: kits suitable for this type of research

NUP43 Polyclonal Antibody, Biotin Conjugated

A66777 100 µg
EUR 570.55
Description: fast delivery possible

Nup43 ORF Vector (Rat) (pORF)

ORF071622 1.0 ug DNA
EUR 506

NUP43 ORF Vector (Human) (pORF)

ORF007306 1.0 ug DNA
EUR 95

Nup43 ORF Vector (Mouse) (pORF)

ORF051834 1.0 ug DNA
EUR 506

Nup43 sgRNA CRISPR Lentivector set (Rat)

K7508401 3 x 1.0 ug
EUR 339

Nup43 sgRNA CRISPR Lentivector set (Mouse)

K3850401 3 x 1.0 ug
EUR 339

NUP43 sgRNA CRISPR Lentivector set (Human)

K1467601 3 x 1.0 ug
EUR 339

Nup43 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7508402 1.0 ug DNA
EUR 154

Nup43 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7508403 1.0 ug DNA
EUR 154

Nup43 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7508404 1.0 ug DNA
EUR 154

Nup43 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3850402 1.0 ug DNA
EUR 154

Nup43 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3850403 1.0 ug DNA
EUR 154

Nup43 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3850404 1.0 ug DNA
EUR 154

NUP43 sgRNA CRISPR Lentivector (Human) (Target 1)

K1467602 1.0 ug DNA
EUR 154

NUP43 sgRNA CRISPR Lentivector (Human) (Target 2)

K1467603 1.0 ug DNA
EUR 154

NUP43 sgRNA CRISPR Lentivector (Human) (Target 3)

K1467604 1.0 ug DNA
EUR 154

NUP43 Protein Vector (Rat) (pPB-C-His)

PV286486 500 ng
EUR 603

NUP43 Protein Vector (Rat) (pPB-N-His)

PV286487 500 ng
EUR 603

NUP43 Protein Vector (Rat) (pPM-C-HA)

PV286488 500 ng
EUR 603

NUP43 Protein Vector (Rat) (pPM-C-His)

PV286489 500 ng
EUR 603

NUP43 Protein Vector (Mouse) (pPB-C-His)

PV207334 500 ng
EUR 603

NUP43 Protein Vector (Mouse) (pPB-N-His)

PV207335 500 ng
EUR 603

NUP43 Protein Vector (Mouse) (pPM-C-HA)

PV207336 500 ng
EUR 603

NUP43 Protein Vector (Mouse) (pPM-C-His)

PV207337 500 ng
EUR 603

NUP43 Protein Vector (Human) (pPB-C-His)

PV029221 500 ng
EUR 329

NUP43 Protein Vector (Human) (pPB-N-His)

PV029222 500 ng
EUR 329

NUP43 Protein Vector (Human) (pPM-C-HA)

PV029223 500 ng
EUR 329

NUP43 Protein Vector (Human) (pPM-C-His)

PV029224 500 ng
EUR 329

Nup43 3'UTR Luciferase Stable Cell Line

TU114440 1.0 ml Ask for price

Nup43 3'UTR GFP Stable Cell Line

TU164440 1.0 ml Ask for price

Nup43 3'UTR Luciferase Stable Cell Line

TU214303 1.0 ml Ask for price

Nup43 3'UTR GFP Stable Cell Line

TU264303 1.0 ml Ask for price

NUP43 3'UTR GFP Stable Cell Line

TU066097 1.0 ml
EUR 2333

NUP43 3'UTR Luciferase Stable Cell Line

TU016097 1.0 ml
EUR 2333

NUP43 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV638539 1.0 ug DNA
EUR 682

NUP43 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV638543 1.0 ug DNA
EUR 682

NUP43 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV638544 1.0 ug DNA
EUR 682

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7508405 3 x 1.0 ug
EUR 376

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3850405 3 x 1.0 ug
EUR 376

NUP43 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1467605 3 x 1.0 ug
EUR 376

NUP43 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV638540 1.0 ug DNA
EUR 682

NUP43 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV638541 1.0 ug DNA
EUR 740

NUP43 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV638542 1.0 ug DNA
EUR 740

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7508406 1.0 ug DNA
EUR 167

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7508407 1.0 ug DNA
EUR 167

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7508408 1.0 ug DNA
EUR 167

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3850406 1.0 ug DNA
EUR 167

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3850407 1.0 ug DNA
EUR 167

Nup43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3850408 1.0 ug DNA
EUR 167

NUP43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1467606 1.0 ug DNA
EUR 167

NUP43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1467607 1.0 ug DNA
EUR 167

NUP43 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1467608 1.0 ug DNA
EUR 167