GNG10

GNG10 siRNA

20-abx918187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG10 Antibody

ABD2205 100 ug
EUR 438

GNG10 Antibody

44666-100ul 100ul
EUR 252

GNG10 Antibody

44666-50ul 50ul
EUR 187

GNG10 Antibody

DF2205 200ul
EUR 304
Description: GNG10 antibody detects endogenous levels of total GNG10.

GNG10 Antibody

1-CSB-PA009610LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GNG10 Conjugated Antibody

C44666 100ul
EUR 397

GNG10 cloning plasmid

CSB-CL009610HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atgtcctccggggctagcgcgagcgccctgcagcgcttggtagagcagctcaagttggaggctggcgtggagaggatcaaggtctctcaggcagctgcagagcttcaacagtactgtatgcagaatgcctgcaaggatgccctgctggtgggtgttccagctggaagtaacccctt
  • Show more
Description: A cloning plasmid for the GNG10 gene.

GNG10 Antibody (HRP)

20-abx304010
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNG10 Antibody (FITC)

20-abx304011
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNG10 Antibody (Biotin)

20-abx304012
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GNG10 Polyclonal Antibody

A59262 100 µg
EUR 570.55
Description: fast delivery possible

GNG10 Rabbit pAb

A8423-100ul 100 ul
EUR 308

GNG10 Rabbit pAb

A8423-200ul 200 ul
EUR 459

GNG10 Rabbit pAb

A8423-20ul 20 ul
EUR 183

GNG10 Rabbit pAb

A8423-50ul 50 ul
EUR 223

GNG10 Blocking Peptide

DF2205-BP 1mg
EUR 195

pCMV-SPORT6-GNG10

PVT13682 2 ug
EUR 391

Anti-GNG10 antibody

STJ110721 100 µl
EUR 277

Mouse Gng10 ELISA KIT

ELI-08181m 96 Tests
EUR 865

Human GNG10 ELISA KIT

ELI-09680h 96 Tests
EUR 824

Mouse GNG10 shRNA Plasmid

20-abx970594
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNG10 shRNA Plasmid

20-abx951861
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG10 Antibody, HRP conjugated

1-CSB-PA009610LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG10 Antibody, FITC conjugated

1-CSB-PA009610LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG10 Antibody, Biotin conjugated

1-CSB-PA009610LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG10 Recombinant Protein (Human)

RP013534 100 ug Ask for price

pCMV-SPORT6-DNAJC25-GNG10

PVT13700 2 ug
EUR 391

GNG10 Recombinant Protein (Rat)

RP203009 100 ug Ask for price

GNG10 Recombinant Protein (Mouse)

RP138995 100 ug Ask for price

GNG10 Polyclonal Antibody, Biotin Conjugated

A59263 100 µg
EUR 570.55
Description: reagents widely cited

GNG10 Polyclonal Antibody, FITC Conjugated

A59264 100 µg
EUR 570.55
Description: Ask the seller for details

GNG10 Polyclonal Antibody, HRP Conjugated

A59265 100 µg
EUR 570.55
Description: The best epigenetics products

GNG10 ORF Vector (Human) (pORF)

ORF004512 1.0 ug DNA
EUR 95

Gng10 ORF Vector (Rat) (pORF)

ORF067671 1.0 ug DNA
EUR 506

Gng10 ORF Vector (Mouse) (pORF)

ORF046333 1.0 ug DNA
EUR 506

DNAJC25-GNG10 Recombinant Protein (Human)

RP055260 100 ug Ask for price

GNG10 sgRNA CRISPR Lentivector set (Human)

K0877701 3 x 1.0 ug
EUR 339

Gng10 sgRNA CRISPR Lentivector set (Mouse)

K3400101 3 x 1.0 ug
EUR 339

Gng10 sgRNA CRISPR Lentivector set (Rat)

K7061201 3 x 1.0 ug
EUR 339

DNAJC25-GNG10 ORF Vector (Human) (pORF)

ORF018421 1.0 ug DNA
EUR 405

GNG10 sgRNA CRISPR Lentivector (Human) (Target 1)

K0877702 1.0 ug DNA
EUR 154

GNG10 sgRNA CRISPR Lentivector (Human) (Target 2)

K0877703 1.0 ug DNA
EUR 154

GNG10 sgRNA CRISPR Lentivector (Human) (Target 3)

K0877704 1.0 ug DNA
EUR 154

DNAJC25-GNG10 sgRNA CRISPR Lentivector set (Human)

K2765201 3 x 1.0 ug
EUR 339

Gng10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3400102 1.0 ug DNA
EUR 154

Gng10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3400103 1.0 ug DNA
EUR 154

Gng10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3400104 1.0 ug DNA
EUR 154

Gng10 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7061202 1.0 ug DNA
EUR 154

Gng10 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7061203 1.0 ug DNA
EUR 154

Gng10 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7061204 1.0 ug DNA
EUR 154

GNG10 Protein Vector (Mouse) (pPB-C-His)

PV185330 500 ng
EUR 603

GNG10 Protein Vector (Mouse) (pPB-N-His)

PV185331 500 ng
EUR 603

GNG10 Protein Vector (Mouse) (pPM-C-HA)

PV185332 500 ng
EUR 603

GNG10 Protein Vector (Mouse) (pPM-C-His)

PV185333 500 ng
EUR 603

GNG10 Protein Vector (Rat) (pPB-C-His)

PV270682 500 ng
EUR 603

GNG10 Protein Vector (Rat) (pPB-N-His)

PV270683 500 ng
EUR 603

GNG10 Protein Vector (Rat) (pPM-C-HA)

PV270684 500 ng
EUR 603

GNG10 Protein Vector (Rat) (pPM-C-His)

PV270685 500 ng
EUR 603

GNG10 Protein Vector (Human) (pPB-C-His)

PV018045 500 ng
EUR 329