GNG10

GNG10 Antibody
44666-50ul	SAB	50ul	EUR 187

GNG10 Antibody
DF2205	Affbiotech	200ul	EUR 304
Description: GNG10 antibody detects endogenous levels of total GNG10.

GNG10 Antibody
1-CSB-PA009610LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GNG10 siRNA
20-abx918186	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG10 siRNA
20-abx918187	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNG10 Antibody
ABD2205	Lifescience Market	100 ug	EUR 438

GNG10 Blocking Peptide
DF2205-BP	Affbiotech	1mg	EUR 195

GNG10 Conjugated Antibody
C44666	SAB	100ul	EUR 397

GNG10 Antibody (HRP)
20-abx304010	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNG10 Antibody (FITC)
20-abx304011	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNG10 Antibody (Biotin)
20-abx304012	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GNG10 cloning plasmid
CSB-CL009610HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 207 Sequence: atgtcctccggggctagcgcgagcgccctgcagcgcttggtagagcagctcaagttggaggctggcgtggagaggatcaaggtctctcaggcagctgcagagcttcaacagtactgtatgcagaatgcctgcaaggatgccctgctggtgggtgttccagctggaagtaacccctt Show more
Description: A cloning plasmid for the GNG10 gene.

GNG10 Polyclonal Antibody
A59262	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNG10 Rabbit pAb
A8423-100ul	Abclonal	100 ul	EUR 308

GNG10 Rabbit pAb
A8423-200ul	Abclonal	200 ul	EUR 459

GNG10 Rabbit pAb
A8423-20ul	Abclonal	20 ul	EUR 183

GNG10 Rabbit pAb
A8423-50ul	Abclonal	50 ul	EUR 223

pCMV-SPORT6-GNG10
PVT13682	Lifescience Market	2 ug	EUR 391

Anti-GNG10 antibody
STJ110721	St John's Laboratory	100 µl	EUR 277

Human GNG10 ELISA KIT
ELI-09680h	Lifescience Market	96 Tests	EUR 824

Mouse Gng10 ELISA KIT
ELI-08181m	Lifescience Market	96 Tests	EUR 865

GNG10 Antibody, HRP conjugated
1-CSB-PA009610LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG10 Antibody, FITC conjugated
1-CSB-PA009610LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG10 Antibody, Biotin conjugated
1-CSB-PA009610LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG10. Recognizes GNG10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNG10 shRNA Plasmid
20-abx951861	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GNG10 shRNA Plasmid
20-abx970594	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-DNAJC25-GNG10
PVT13700	Lifescience Market	2 ug	EUR 391

GNG10 Recombinant Protein (Human)
RP013534	ABM	100 ug	Ask for price

GNG10 Recombinant Protein (Rat)
RP203009	ABM	100 ug	Ask for price

GNG10 Recombinant Protein (Mouse)
RP138995	ABM	100 ug	Ask for price

GNG10 Polyclonal Antibody, Biotin Conjugated
A59263	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNG10 Polyclonal Antibody, FITC Conjugated
A59264	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNG10 Polyclonal Antibody, HRP Conjugated
A59265	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Gng10 ORF Vector (Rat) (pORF)
ORF067671	ABM	1.0 ug DNA	EUR 506

GNG10 ORF Vector (Human) (pORF)
ORF004512	ABM	1.0 ug DNA	EUR 95

Gng10 ORF Vector (Mouse) (pORF)
ORF046333	ABM	1.0 ug DNA	EUR 506

DNAJC25-GNG10 Recombinant Protein (Human)
RP055260	ABM	100 ug	Ask for price

Gng10 sgRNA CRISPR Lentivector set (Rat)
K7061201	ABM	3 x 1.0 ug	EUR 339

Gng10 sgRNA CRISPR Lentivector set (Mouse)
K3400101	ABM	3 x 1.0 ug	EUR 339

GNG10 sgRNA CRISPR Lentivector set (Human)
K0877701	ABM	3 x 1.0 ug	EUR 339

DNAJC25-GNG10 ORF Vector (Human) (pORF)
ORF018421	ABM	1.0 ug DNA	EUR 405

Gng10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7061202	ABM	1.0 ug DNA	EUR 154

Gng10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7061203	ABM	1.0 ug DNA	EUR 154

Gng10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7061204	ABM	1.0 ug DNA	EUR 154

DNAJC25-GNG10 sgRNA CRISPR Lentivector set (Human)
K2765201	ABM	3 x 1.0 ug	EUR 339

Gng10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3400102	ABM	1.0 ug DNA	EUR 154

Gng10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3400103	ABM	1.0 ug DNA	EUR 154

Gng10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3400104	ABM	1.0 ug DNA	EUR 154

GNG10 sgRNA CRISPR Lentivector (Human) (Target 1)
K0877702	ABM	1.0 ug DNA	EUR 154

GNG10 sgRNA CRISPR Lentivector (Human) (Target 2)
K0877703	ABM	1.0 ug DNA	EUR 154

GNG10 sgRNA CRISPR Lentivector (Human) (Target 3)
K0877704	ABM	1.0 ug DNA	EUR 154

GNG10 Protein Vector (Rat) (pPB-C-His)
PV270682	ABM	500 ng	EUR 603

GNG10 Protein Vector (Rat) (pPB-N-His)
PV270683	ABM	500 ng	EUR 603

GNG10 Protein Vector (Rat) (pPM-C-HA)
PV270684	ABM	500 ng	EUR 603

GNG10 Protein Vector (Rat) (pPM-C-His)
PV270685	ABM	500 ng	EUR 603

GNG10 Protein Vector (Mouse) (pPB-C-His)
PV185330	ABM	500 ng	EUR 603

GNG10 Protein Vector (Mouse) (pPB-N-His)
PV185331	ABM	500 ng	EUR 603

GNG10 Protein Vector (Mouse) (pPM-C-HA)
PV185332	ABM	500 ng	EUR 603

GNG10 Protein Vector (Mouse) (pPM-C-His)
PV185333	ABM	500 ng	EUR 603

GNG10 Protein Vector (Human) (pPB-C-His)
PV018045	ABM	500 ng	EUR 329