B4GALNT2

Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) ELISA Kit

DLR-b4GALNT2-Hu-96T 96T
EUR 673
  • Should the Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) in samples from tissue homogenates or other biological fluids.

Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) ELISA Kit

RDR-b4GALNT2-Hu-48Tests 48 Tests
EUR 544

Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) ELISA Kit

RDR-b4GALNT2-Hu-96Tests 96 Tests
EUR 756

Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) ELISA Kit

RD-b4GALNT2-Hu-48Tests 48 Tests
EUR 521

Human Beta-1,4-N-Acetyl Galactosaminyl Transferase 2 (b4GALNT2) ELISA Kit

RD-b4GALNT2-Hu-96Tests 96 Tests
EUR 723

B4GALNT2 Antibody

45806-100ul 100ul
EUR 252

B4GALNT2 Antibody

45806-50ul 50ul
EUR 187

B4GALNT2 Antibody

46328-100ul 100ul
EUR 252

B4GALNT2 Antibody

1-CSB-PA854161LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALNT2. Recognizes B4GALNT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

B4GALNT2 Antibody

DF9272 200ul
EUR 304
Description: B4GALNT2 Antibody detects endogenous levels of total B4GALNT2.

B4GALNT2 siRNA

20-abx908796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALNT2 siRNA

20-abx908797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

B4GALNT2 Antibody

ABD9272 100 ug
EUR 438

B4GALNT2 Blocking Peptide

DF9272-BP 1mg
EUR 195

B4GALNT2 Conjugated Antibody

C45806 100ul
EUR 397

B4GALNT2 Conjugated Antibody

C46328 100ul
EUR 397

B4GALNT2 cloning plasmid

CSB-CL854161HU1-10ug 10ug
EUR 586
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1701
  • Sequence: atggggagcgctggcttttccgtgggaaaattccacgtggaggtggcctctcgcggccgggaatgtgtctcggggacgcccgagtgtgggaatcggctcgggagtgcgggcttcggggatctctgcttggaactcagaggcgctgacccagcctggggcccgtttgctgcccacg
  • Show more
Description: A cloning plasmid for the B4GALNT2 gene.

B4GALNT2 cloning plasmid

CSB-CL854161HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1701
  • Sequence: atggggagcgctggcttttccgtgggaaaattccacgtggaggtggcctctcgcggccgggaatgtgtctcggggacgcccgagtgtgggaatcggctcgggagtgcgggcttcggggatctctgcttggaactcagaggcgctgacccagcctggggcccgtttgctgcccacg
  • Show more
Description: A cloning plasmid for the B4GALNT2 gene.

B4GALNT2 Polyclonal Antibody

A67050 100 µg
EUR 570.55
Description: reagents widely cited

anti- B4GALNT2 antibody

FNab00772 100µg
EUR 505.25
  • Immunogen: beta-1,4-N-acetyl-galactosaminyl transferase 2
  • Uniprot ID: Q8NHY0
  • Gene ID: 124872
  • Research Area: Stem Cells, Metabolism, Developmental biology
Description: Antibody raised against B4GALNT2

Anti-B4GALNT2 antibody

PAab00772 100 ug
EUR 355

B4GALNT2 Antibody, HRP conjugated

1-CSB-PA854161LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALNT2. Recognizes B4GALNT2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

B4GALNT2 Antibody, FITC conjugated

1-CSB-PA854161LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALNT2. Recognizes B4GALNT2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

B4GALNT2 Antibody, Biotin conjugated

1-CSB-PA854161LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against B4GALNT2. Recognizes B4GALNT2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human B4GALNT2 ELISA KIT

ELI-23967h 96 Tests
EUR 824

B4GALNT2 ELISA KIT|Human

EF008041 96 Tests
EUR 689

Human B4GALNT2 shRNA Plasmid

20-abx964788
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse B4GALNT2 shRNA Plasmid

20-abx970456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse B4galnt2 ELISA KIT

ELI-34252m 96 Tests
EUR 865

B4GALNT2 Recombinant Protein (Human)

RP036892 100 ug Ask for price

B4GALNT2 Recombinant Protein (Human)

RP036895 100 ug Ask for price

B4GALNT2 Recombinant Protein (Mouse)

RP118562 100 ug Ask for price

B4GALNT2 Polyclonal Antibody, HRP Conjugated

A67051 100 µg
EUR 570.55
Description: Ask the seller for details

B4GALNT2 Polyclonal Antibody, FITC Conjugated

A67052 100 µg
EUR 570.55
Description: The best epigenetics products

B4GALNT2 Polyclonal Antibody, Biotin Conjugated

A67053 100 µg
EUR 570.55
Description: kits suitable for this type of research

B4GALNT2 ORF Vector (Human) (pORF)

ORF012298 1.0 ug DNA
EUR 354

B4GALNT2 ORF Vector (Human) (pORF)

ORF012299 1.0 ug DNA
EUR 354

B4galnt2 ORF Vector (Mouse) (pORF)

ORF039522 1.0 ug DNA
EUR 506

B4GALNT2 ELISA Kit (Human) (OKCD01059)

OKCD01059 96 Wells
EUR 831
Description: Description of target: Involved in the synthesis of the Sd(a) antigen (Sia-alpha2,3-[GalNAc-beta1,4]Gal-beta1,4-GlcNAc), a carbohydrate determinant expressed on erythrocytes, the colonic mucosa and other tissues. Transfers a beta-1,4-linked GalNAc to the galactose residue of an alpha-2,3-sialylated chain.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Molecular cloning, gene organization and expression of the human UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase responsible for the biosynthesis of the blood group Sda/Cad antigen: evidence for an unusual extended cytoplasmic domain."_x005F_x005F_x000D_Montiel M.D., Krzewinski-Recchi M.A., Delannoy P., Harduin-Lepers A._x005F_x005F_x000D_Biochem. J. 373:369-379(2003) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORMS 1 AND 2), FUNCTION, TISSUE SPECIFICITY, VARIANT ASP-40.Ref.2"Molecular cloning of the human beta1,4 N-acetylgalactosaminyltransferase responsible for the biosynthesis of the Sd(a) histo-blood group antigen: the sequence predicts a very long cytoplasmic domain."_x005F_x005F_x000D_Lo Presti L., Cabuy E., Chiricolo M., Dall'Olio F._x005F_x005F_x000D_J. Biochem. 134:675-682(2003) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, VARIANT ASP-40. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: protein glycosylationThis protein is involved in the pathway protein glycosylation, which is part of Protein modification._x005F_x005F_x000D_View all proteins of this organism that are known to be involved in the pathway protein glycosylation and in Protein modification. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

B4GALNT2 sgRNA CRISPR Lentivector set (Human)

K0164801 3 x 1.0 ug
EUR 339

B4galnt2 sgRNA CRISPR Lentivector set (Mouse)

K3875901 3 x 1.0 ug
EUR 339

Beta-1,4 N-Acetylgalactosaminyltransferase 2 (B4GALNT2) Antibody

abx037191-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Beta-1,4 N-Acetylgalactosaminyltransferase 2 (B4GALNT2) Antibody

20-abx148497
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta-1,4 N-Acetylgalactosaminyltransferase 2 (B4GALNT2) Antibody

20-abx301623
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Beta-1,4 N-Acetylgalactosaminyltransferase 2 (B4GALNT2) Antibody

abx230772-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

B4GALNT2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0164802 1.0 ug DNA
EUR 154

B4GALNT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0164803 1.0 ug DNA
EUR 154

B4GALNT2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0164804 1.0 ug DNA
EUR 154

B4galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3875902 1.0 ug DNA
EUR 154

B4galnt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3875903 1.0 ug DNA
EUR 154