VNN2 Antibody
39964-100ul 100ul
EUR 390
VNN2 Antibody
DF9037 200ul
EUR 304
Description: VNN2 Antibody detects endogenous levels of total VNN2.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VNN2 Antibody
ABD9037 100 ug
EUR 438
YF-PA15943 50 ug
EUR 363
Description: Mouse polyclonal to VNN2
pENTR223- VNN2
PVT11610 2 ug
EUR 273
VNN2 Polyclonal Antibody
31458-100ul 100ul
EUR 252
VNN2 Polyclonal Antibody
31458-50ul 50ul
EUR 187
VNN2 Blocking Peptide
33R-3046 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VNN2 antibody, catalog no. 70R-10375
VNN2 Blocking Peptide
DF9037-BP 1mg
EUR 195
VNN2 cloning plasmid
CSB-CL025884HU1-10ug 10ug
EUR 548
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1563
  • Sequence: atggtcacttcctcttttccaatctctgtggcagtttttgccctaataaccctgcaggttggtactcaggacagttttatagctgcagtgtatgaacatgctgtcattttgccaaataaaacagaaacaccagtttctcaggaggatgccttgaatctcatgaacgagaatatag
  • Show more
Description: A cloning plasmid for the VNN2 gene.
VNN2 cloning plasmid
CSB-CL025884HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1563
  • Sequence: atggtcacttcctcttttccaatctctgtggcagtttttgccctaataaccctgcaggttggtactcaggacagttttatagctgcagtgtatgaacatgctgtcattttgccaaataaaacagaaacaccagtttctcaggaggatgccttgaatctcatgaacgagaatatag
  • Show more
Description: A cloning plasmid for the VNN2 gene.
VNN2 Rabbit pAb
A8170-100ul 100 ul
EUR 308
VNN2 Rabbit pAb
A8170-200ul 200 ul
EUR 459
VNN2 Rabbit pAb
A8170-20ul 20 ul
EUR 183
VNN2 Rabbit pAb
A8170-50ul 50 ul
EUR 223
VNN2 Polyclonal Antibody
ABP60897-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VNN2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of VNN2 from Human. This VNN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VNN2 protein at amino acid sequence of 320-400
VNN2 Polyclonal Antibody
ABP60897-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VNN2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of VNN2 from Human. This VNN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VNN2 protein at amino acid sequence of 320-400
VNN2 Polyclonal Antibody
ABP60897-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VNN2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of VNN2 from Human. This VNN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VNN2 protein at amino acid sequence of 320-400
VNN2 Polyclonal Antibody
ES9228-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VNN2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
VNN2 Polyclonal Antibody
ES9228-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VNN2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
anti- VNN2 antibody
FNab09422 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IF: 1:20-1:200
  • Immunogen: vanin 2
  • Uniprot ID: O95498
  • Gene ID: 8875
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against VNN2
Anti-VNN2 antibody
PAab09422 100 ug
EUR 412
Anti-VNN2 antibody
STJ110469 100 µl
EUR 277
Description: This gene product is a member of the Vanin family of proteins that share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. The encoded protein is a GPI-anchored cell surface molecule that plays a role in transendothelial migration of neutrophils. This gene lies in close proximity to, and in same transcriptional orientation as two other vanin genes on chromosome 6q23-q24. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.
Anti-VNN2 antibody
STJ190386 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VNN2
Vanin 2 (VNN2) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
EF004203 96 Tests
EUR 689
VNN2 Polyclonal Conjugated Antibody
C31458 100ul
EUR 397
Human VNN2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PVT13367 2 ug
EUR 599
VNN2 Recombinant Protein (Human)
RP044782 100 ug Ask for price
VNN2 Recombinant Protein (Human)
RP044785 100 ug Ask for price
Human Vanin 2 (VNN2) Protein
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
VNN2 ORF Vector (Human) (pORF)
ORF014928 1.0 ug DNA
EUR 354
VNN2 ORF Vector (Human) (pORF)
ORF014929 1.0 ug DNA
EUR 354
VNN2 sgRNA CRISPR Lentivector set (Human)
K2616601 3 x 1.0 ug
EUR 339
Human Vanin 2(VNN2)ELISA Kit
QY-E00736 96T
EUR 361
Vascular Non-Inflammatory Molecule 2 (VNN2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Vascular Non-Inflammatory Molecule 2 (VNN2) Antibody
abx037270-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Vascular Non-Inflammatory Molecule 2 (VNN2) Antibody
abx239422-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Recombinant Human Vanin-2/VNN2 (C-6His)
C651-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.
Recombinant Human Vanin-2/VNN2 (C-6His)
C651-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.
Recombinant Human Vanin-2/VNN2 (C-6His)
C651-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.
Recombinant Human Vanin-2/VNN2 (C-6His)
C651-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.
VNN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2616602 1.0 ug DNA
EUR 154
VNN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2616603 1.0 ug DNA
EUR 154
VNN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2616604 1.0 ug DNA
EUR 154
VNN2 3'UTR GFP Stable Cell Line
TU078270 1.0 ml
EUR 1394
VNN2 3'UTR Luciferase Stable Cell Line
TU028270 1.0 ml
EUR 1394
VNN2 Protein Vector (Human) (pPB-C-His)
PV059709 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPB-N-His)
PV059710 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPM-C-HA)
PV059711 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPM-C-His)
PV059712 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPB-C-His)
PV059713 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPB-N-His)
PV059714 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPM-C-HA)
PV059715 500 ng
EUR 481
VNN2 Protein Vector (Human) (pPM-C-His)
PV059716 500 ng
EUR 481
VNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702621 1.0 ug DNA
EUR 450
VNN2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702625 1.0 ug DNA
EUR 450
VNN2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702626 1.0 ug DNA
EUR 450
Human Vascular non- inflammatory molecule 2, VNN2 ELISA KIT
ELI-28525h 96 Tests
EUR 824
Human Vascular non-inflammatory molecule 2 (VNN2) ELISA Kit
abx384232-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
VNN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2616605 3 x 1.0 ug
EUR 376
VNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV702622 1.0 ug DNA
EUR 450
VNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV702623 1.0 ug DNA
EUR 508
VNN2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV702624 1.0 ug DNA
EUR 508
VNN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2616606 1.0 ug DNA
EUR 167
VNN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2616607 1.0 ug DNA
EUR 167
VNN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2616608 1.0 ug DNA
EUR 167