YF-PA25427 50 ul
EUR 334
Description: Mouse polyclonal to SEC24D
Human Protein transport protein Sec24D, SEC24D ELISA KIT
ELI-29477h 96 Tests
EUR 824
SEC24D Polyclonal Antibody
29721-100ul 100ul
EUR 252
SEC24D Polyclonal Antibody
29721-50ul 50ul
EUR 187
SEC24D Rabbit pAb
A16091-100ul 100 ul
EUR 308
SEC24D Rabbit pAb
A16091-200ul 200 ul
EUR 459
SEC24D Rabbit pAb
A16091-20ul 20 ul
EUR 183
SEC24D Rabbit pAb
A16091-50ul 50 ul
EUR 223
SEC24D cloning plasmid
CSB-CL020953HU-10ug 10ug
EUR 1144
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3102
  • Sequence: atgagtcaacaaggttacgtggctacacctccgtattctcagcctcagcctggaataggcctttctccacctcattatgggcactatggggatccgtcgcacacagcatctccaacaggtatgatgaagccagcagggcctttgggggccaccgccactaggggaatgttgcctc
  • Show more
Description: A cloning plasmid for the SEC24D gene.
Anti-SEC24D (1A8)
YF-MA11217 100 ug
EUR 363
Description: Mouse monoclonal to SEC24D
Anti-SEC24D (2D4)
YF-MA17028 100 ug
EUR 363
Description: Mouse monoclonal to SEC24D
Anti-SEC24D antibody
STJ118544 100 µl
EUR 277
Anti-SEC24D Antibody
STJ502903 100 µg
EUR 476
pDONR223-SEC24D Plasmid
PVTB00921 2 ug
EUR 356
SEC24D Polyclonal Conjugated Antibody
C29721 100ul
EUR 397
Human SEC24D shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SEC24D Antibody (Biotin)
STJ502904 100 µg
EUR 586
Anti-SEC24D Antibody FITC
STJ502905 100 µg
EUR 586
Polyclonal SEC24D Antibody (N-Term)
AMM07745G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC24D (N-Term). This antibody is tested and proven to work in the following applications:
SEC24D ORF Vector (Human) (pORF)
ORF009304 1.0 ug DNA
EUR 95
Sec24d ORF Vector (Mouse) (pORF)
ORF056861 1.0 ug DNA
EUR 506
Sec24d sgRNA CRISPR Lentivector set (Mouse)
K3149701 3 x 1.0 ug
EUR 339
SEC24D sgRNA CRISPR Lentivector set (Human)
K2113801 3 x 1.0 ug
EUR 339
Monoclonal SEC24D Antibody (monoclonal) (M04), Clone: 1A8
AMM07744G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SEC24D (monoclonal) (M04). The antibodies are raised in Mouse and are from clone 1A8. This antibody is applicable in WB
Sec24d sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3149702 1.0 ug DNA
EUR 154
Sec24d sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3149703 1.0 ug DNA
EUR 154
Sec24d sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3149704 1.0 ug DNA
EUR 154
SEC24D sgRNA CRISPR Lentivector (Human) (Target 1)
K2113802 1.0 ug DNA
EUR 154
SEC24D sgRNA CRISPR Lentivector (Human) (Target 2)
K2113803 1.0 ug DNA
EUR 154
SEC24D sgRNA CRISPR Lentivector (Human) (Target 3)
K2113804 1.0 ug DNA
EUR 154
SEC24D 3'UTR Luciferase Stable Cell Line
TU022841 1.0 ml
EUR 2333
Sec24d 3'UTR Luciferase Stable Cell Line
TU118503 1.0 ml Ask for price
Sec24d 3'UTR GFP Stable Cell Line
TU168503 1.0 ml Ask for price
SEC24D 3'UTR GFP Stable Cell Line
TU072841 1.0 ml
EUR 2333
SEC24D Protein Vector (Mouse) (pPB-C-His)
PV227442 500 ng
EUR 1065
SEC24D Protein Vector (Mouse) (pPB-N-His)
PV227443 500 ng
EUR 1065
SEC24D Protein Vector (Mouse) (pPM-C-HA)
PV227444 500 ng
EUR 1065
SEC24D Protein Vector (Mouse) (pPM-C-His)
PV227445 500 ng
EUR 1065
SEC24D Protein Vector (Human) (pPB-C-His)
PV037213 500 ng
EUR 329
SEC24D Protein Vector (Human) (pPB-N-His)
PV037214 500 ng
EUR 329
SEC24D Protein Vector (Human) (pPM-C-HA)
PV037215 500 ng
EUR 329
SEC24D Protein Vector (Human) (pPM-C-His)
PV037216 500 ng
EUR 329
Sec24d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3149705 3 x 1.0 ug
EUR 376
SEC24D sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2113805 3 x 1.0 ug
EUR 376
Sec24d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3149706 1.0 ug DNA
EUR 167
Sec24d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3149707 1.0 ug DNA
EUR 167
Sec24d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3149708 1.0 ug DNA
EUR 167
SEC24D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2113806 1.0 ug DNA
EUR 167
SEC24D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2113807 1.0 ug DNA
EUR 167
SEC24D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2113808 1.0 ug DNA
EUR 167