NFKBIA antibody

70R-10440 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NFKBIA antibody

NFKBIA antibody

70R-10522 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NFKBIA antibody

NFKBIA Antibody

32213-100ul 100ul
EUR 252

NFKBIA antibody

10R-1214 100 ug
EUR 512
Description: Mouse monoclonal NFKBIA antibody

NFKBIA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NFKBIA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

NFKBIA Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFKBIA Antibody

CSB-PA125146-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFKBIA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

NFKBIA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

NFKBIA Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NFKBIA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

NFKBIA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

NFKBIA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFKBIA Antibody

ABD6321 100 ug
EUR 438

NFKBIA Blocking Peptide

33R-3026 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NFKBIA antibody, catalog no. 70R-10440

NFKBIA Blocking Peptide

33R-8703 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NFKBIA antibody, catalog no. 70R-10522

NFKBIA (pSer32) Antibody

abx032083-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NFKBIA (pSer32) Antibody

abx032083-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NFKBIA Conjugated Antibody

C32213 100ul
EUR 397

NFKBIA (pY305) Antibody

abx333558-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Monoclonal NFKBIA Antibody

AMM02461G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human NFKBIA. The antibodies are raised in Mouse. This antibody is applicable in WB

NFKBIA cloning plasmid

CSB-CL015761HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggt
  • Show more
Description: A cloning plasmid for the NFKBIA gene.

NFKBIA cloning plasmid

CSB-CL015761HU2-10ug 10ug
EUR 377
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggt
  • Show more
Description: A cloning plasmid for the NFKBIA gene.

NFKBIA Rabbit pAb

A16929-100ul 100 ul
EUR 308

NFKBIA Rabbit pAb

A16929-200ul 200 ul
EUR 459

NFKBIA Rabbit pAb

A16929-20ul 20 ul
EUR 183

NFKBIA Rabbit pAb

A16929-50ul 50 ul
EUR 223

NFKBIA (pY42) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-NFKBIA antibody

STJ111154 100 µl
EUR 393
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody

STJ24763 100 µl
EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody

STJ112997 100 µl
EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody

STJ113118 100 µl
EUR 413
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody

STJ113723 100 µl
EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody

STJ113807 100 µl
EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody

STJ119264 100 µl
EUR 277


PVT19079 2 ug
EUR 258

Phospho-NFKBIA (Tyr305) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr305). Recognizes Phospho-NFKBIA (Tyr305) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-NFKBIA (Tyr305) Antibody

CSB-PA083307-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr305). Recognizes Phospho-NFKBIA (Tyr305) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-NFKBIA (Tyr42) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr42). Recognizes Phospho-NFKBIA (Tyr42) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-NFKBIA (Tyr42) Antibody

CSB-PA945133-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr42). Recognizes Phospho-NFKBIA (Tyr42) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

NFKBIA protein (His tag)

80R-2014 50 ug
EUR 457
Description: Recombinant human NFKBIA protein (His tag)


ELA-E1848h 96 Tests
EUR 824


EF006279 96 Tests
EUR 689

Mouse NFKBIA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NFKBIA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-NFKBIA (Y42) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-NFKBIA (Y42). Recognizes Phospho-NFKBIA (Y42) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-NFKBIA (Y305) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-NFKBIA (Y305). Recognizes Phospho-NFKBIA (Y305) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Human NFKBIA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFKBIA Recombinant Protein (Human)

RP021145 100 ug Ask for price

NFKBIA Recombinant Protein (Human)

RP021148 100 ug Ask for price

NFKBIA Recombinant Protein (Mouse)

RP153947 100 ug Ask for price

NFKBIA Recombinant Protein (Rat)

RP213824 100 ug Ask for price

Phospho-NFKBIA (S32/S36) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-NFKBIA (S32/S36). Recognizes Phospho-NFKBIA (S32/S36) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Phospho-NFKBIA (Ser32/Ser36) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Ser32/Ser36). Recognizes Phospho-NFKBIA (Ser32/Ser36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-NFKBIA (Ser32/Ser36) Antibody

CSB-PA093630-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Ser32/Ser36). Recognizes Phospho-NFKBIA (Ser32/Ser36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Polyclonal Phospho-NFKBIA(Ser32)) Antibody

APR05231G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-NFKBIA(Ser32)) . This antibody is tested and proven to work in the following applications:

Phospho-NFKBIA-S32 Rabbit pAb

AP0731-100ul 100 ul
EUR 384

Phospho-NFKBIA-S32 Rabbit pAb

AP0731-200ul 200 ul
EUR 554

Phospho-NFKBIA-S32 Rabbit pAb

AP0731-20ul 20 ul
EUR 183

Phospho-NFKBIA-S32 Rabbit pAb

AP0731-50ul 50 ul
EUR 265

Phospho-NFKBIA-S36 Rabbit pAb

AP1069-100ul 100 ul
EUR 384

Phospho-NFKBIA-S36 Rabbit pAb

AP1069-200ul 200 ul
EUR 554

Phospho-NFKBIA-S36 Rabbit pAb

AP1069-20ul 20 ul
EUR 183

Phospho-NFKBIA-S36 Rabbit pAb

AP1069-50ul 50 ul
EUR 265

NFKBIA (Ab-32/36) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NFKBIA (Ab-32/36) Antibody

CSB-PA587028-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NFKBIA (Ab-32/36) Antibody

EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

NFKBIA (Ab-32/36) Antibody

CSB-PA593749-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

abx159628-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

abx331896-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

abx331998-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

abx332390-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nfkbia ORF Vector (Rat) (pORF)

ORF071276 1.0 ug DNA
EUR 506

h NFKBIA inducible lentiviral particles

LVP168 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NFKBIA, is fully sequence verified and matched to NCBI accession ID: NM_020529.2

NFKBIA ORF Vector (Human) (pORF)

ORF007049 1.0 ug DNA
EUR 95

NFKBIA ORF Vector (Human) (pORF)

ORF007050 1.0 ug DNA
EUR 95

Nfkbia ORF Vector (Mouse) (pORF)

ORF051317 1.0 ug DNA
EUR 506

NFKBIA ELISA Kit (Human) (OKEH04030)

OKEH04030 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

NFKBIA ELISA Kit (Human) (OKCD07726)

OKCD07726 96 Wells
EUR 936
Description: Description of target: NFKB1 or NFKB2 is bound to REL, RELA, or RELB to form the NFKB complex. The NFKB complex is inhibited by I-kappa-B proteins (NFKBIA or NFKBIB), which inactivate NF-kappa-B by trapping it in the cytoplasm. Phosphorylation of serine residues on the I-kappa-B proteins by kinases (IKBKA, or IKBKB) marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B complex. Activated NFKB complex translocates into the nucleus and binds DNA at kappa-B-binding motifs such as 5-prime GGGRNNYYCC 3-prime or 5-prime HGGARNYYCC 3-prime (where H is A, C, or T; R is an A or G purine; and Y is a C or T pyrimidine).;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL

NFKBIA ELISA Kit (Mouse) (OKCD07727)

OKCD07727 96 Wells
EUR 818
Description: Description of target: Inhibits the activity of dimeric NF-kappa-B/REL complexes by trapping REL dimers in the cytoplasm through masking of their nuclear localization signals. On cellular stimulation by immune and proinflammatory responses, becomes phosphorylated promoting ubiquitination and degradation, enabling the dimeric RELA to translocate to the nucleus and activate transcription.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

NFKBIA ELISA Kit (Mouse) (OKEH06432)

OKEH06432 96 Wells
EUR 662
Description: Description of target: Inhibits the activity of dimeric NF-kappa-B/REL complexes by trapping REL dimers in the cytoplasm through masking of their nuclear localization signals. On cellular stimulation by immune and proinflammatory responses, becomes phosphorylated promoting ubiquitination and degradation, enabling the dimeric RELA to translocate to the nucleus and activate transcription.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.183 ng/mL

Nfkbia ELISA Kit (Rat) (OKEH04544)

OKEH04544 96 Wells
EUR 596
Description: Description of target: Inhibitor of NF-kappa-B; binds NF kappa B and retains it in the cytoplasm.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

NFKBIA ELISA Kit (Human) (OKAN04838)

OKAN04838 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL

Anti-Phospho-NFKBIA-S36 antibody

STJ11101107 100 µl
EUR 393
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.