NFKBIA

NFKBIA antibody
70R-10440	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal NFKBIA antibody

NFKBIA antibody
70R-10522	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal NFKBIA antibody

NFKBIA Antibody
32213-100ul	SAB	100ul	EUR 252

NFKBIA antibody
10R-1214	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal NFKBIA antibody

NFKBIA Antibody
1-CSB-PA003073	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NFKBIA Antibody
1-CSB-PA080218	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:2000-5000.IHC:1:200-500

NFKBIA Antibody
CSB-PA125146-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFKBIA Antibody
CSB-PA125146-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFKBIA Antibody
1-CSB-PA984502	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

NFKBIA Antibody
1-CSB-PA302717	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

NFKBIA Antibody
1-CSB-PA015761GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NFKBIA Antibody
1-CSB-PA178504	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

NFKBIA Antibody
1-CSB-PA010535	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

NFKBIA Antibody
1-CSB-PA020113	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFKBIA. Recognizes NFKBIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

NFKBIA siRNA
20-abx903548	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NFKBIA siRNA
20-abx925829	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NFKBIA siRNA
20-abx925830	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NFKBIA Antibody
ABD6321	Lifescience Market	100 ug	EUR 438

NFKBIA Blocking Peptide
33R-3026	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NFKBIA antibody, catalog no. 70R-10440

NFKBIA Blocking Peptide
33R-8703	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NFKBIA antibody, catalog no. 70R-10522

NFKBIA (pSer32) Antibody
abx032083-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

NFKBIA (pSer32) Antibody
abx032083-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

NFKBIA Conjugated Antibody
C32213	SAB	100ul	EUR 397

NFKBIA (pY305) Antibody
abx333558-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Monoclonal NFKBIA Antibody
AMM02461G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human NFKBIA. The antibodies are raised in Mouse. This antibody is applicable in WB

NFKBIA cloning plasmid
CSB-CL015761HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggt Show more
Description: A cloning plasmid for the NFKBIA gene.

NFKBIA cloning plasmid
CSB-CL015761HU2-10ug	Cusabio	10ug	EUR 377
Formulation: 10 μg plasmid + 200μl Glycerol Length: 954 Sequence: atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggt Show more
Description: A cloning plasmid for the NFKBIA gene.

NFKBIA Rabbit pAb
A16929-100ul	Abclonal	100 ul	EUR 308

NFKBIA Rabbit pAb
A16929-200ul	Abclonal	200 ul	EUR 459

NFKBIA Rabbit pAb
A16929-20ul	Abclonal	20 ul	EUR 183

NFKBIA Rabbit pAb
A16929-50ul	Abclonal	50 ul	EUR 223

NFKBIA (pY42) Antibody
20-abx000467	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

pCAGGS-Myc-NFKBIA
PVT19079	Lifescience Market	2 ug	EUR 258

Anti-NFKBIA antibody
STJ111154	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody
STJ24763	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody
STJ112997	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody
STJ113118	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody
STJ113723	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody
STJ113807	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-NFKBIA antibody
STJ119264	St John's Laboratory	100 µl	EUR 277

Phospho-NFKBIA (Tyr305) Antibody
CSB-PA083307-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr305). Recognizes Phospho-NFKBIA (Tyr305) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-NFKBIA (Tyr305) Antibody
CSB-PA083307-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr305). Recognizes Phospho-NFKBIA (Tyr305) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-NFKBIA (Tyr42) Antibody
CSB-PA945133-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr42). Recognizes Phospho-NFKBIA (Tyr42) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-NFKBIA (Tyr42) Antibody
CSB-PA945133-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Tyr42). Recognizes Phospho-NFKBIA (Tyr42) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

NFKBIA protein (His tag)
80R-2014	Fitzgerald	50 ug	EUR 457
Description: Recombinant human NFKBIA protein (His tag)

Human NFKBIA ELISA Kit
ELA-E1848h	Lifescience Market	96 Tests	EUR 824

NFKBIA ELISA KIT|Human
EF006279	Lifescience Market	96 Tests	EUR 689

Mouse NFKBIA shRNA Plasmid
20-abx971732	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NFKBIA shRNA Plasmid
20-abx985067	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-NFKBIA (Y42) Antibody
1-CSB-PA020110	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-NFKBIA (Y42). Recognizes Phospho-NFKBIA (Y42) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-NFKBIA (Y305) Antibody
1-CSB-PA020112	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-NFKBIA (Y305). Recognizes Phospho-NFKBIA (Y305) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Human NFKBIA shRNA Plasmid
20-abx953179	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NFKBIA Recombinant Protein (Human)
RP021145	ABM	100 ug	Ask for price

NFKBIA Recombinant Protein (Human)
RP021148	ABM	100 ug	Ask for price

NFKBIA Recombinant Protein (Mouse)
RP153947	ABM	100 ug	Ask for price

NFKBIA Recombinant Protein (Rat)
RP213824	ABM	100 ug	Ask for price

Phospho-NFKBIA (S32/S36) Antibody
1-CSB-PA000559	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-NFKBIA (S32/S36). Recognizes Phospho-NFKBIA (S32/S36) from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

Phospho-NFKBIA (Ser32/Ser36) Antibody
CSB-PA093630-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Ser32/Ser36). Recognizes Phospho-NFKBIA (Ser32/Ser36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Phospho-NFKBIA (Ser32/Ser36) Antibody
CSB-PA093630-100ul	Cusabio	100ul	EUR 362
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-NFKBIA (Ser32/Ser36). Recognizes Phospho-NFKBIA (Ser32/Ser36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:100, IF:1:100-1:200

Polyclonal Phospho-NFKBIA(Ser32)) Antibody
APR05231G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-NFKBIA(Ser32)) . This antibody is tested and proven to work in the following applications:

Phospho-NFKBIA-S32 Rabbit pAb
AP0731-100ul	Abclonal	100 ul	EUR 384

Phospho-NFKBIA-S32 Rabbit pAb
AP0731-200ul	Abclonal	200 ul	EUR 554

Phospho-NFKBIA-S32 Rabbit pAb
AP0731-20ul	Abclonal	20 ul	EUR 183

Phospho-NFKBIA-S32 Rabbit pAb
AP0731-50ul	Abclonal	50 ul	EUR 265

Phospho-NFKBIA-S36 Rabbit pAb
AP1069-100ul	Abclonal	100 ul	EUR 384

Phospho-NFKBIA-S36 Rabbit pAb
AP1069-200ul	Abclonal	200 ul	EUR 554

Phospho-NFKBIA-S36 Rabbit pAb
AP1069-20ul	Abclonal	20 ul	EUR 183

Phospho-NFKBIA-S36 Rabbit pAb
AP1069-50ul	Abclonal	50 ul	EUR 265

NFKBIA (Ab-32/36) Antibody
CSB-PA587028-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NFKBIA (Ab-32/36) Antibody
CSB-PA587028-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NFKBIA (Ab-32/36) Antibody
CSB-PA593749-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

NFKBIA (Ab-32/36) Antibody
CSB-PA593749-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against NFKBIA (Ab-32/36). Recognizes NFKBIA (Ab-32/36) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:1000, IHC:1:50-1:200, IF:1:100-1:200

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx213970	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx214290	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
abx159628-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx329189	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx329741	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx330121	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
abx331896-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
abx331998-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
abx332390-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx326782	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

NFKB Inhibitor Alpha (NFKBIA) Antibody
20-abx327902	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Nfkbia ORF Vector (Rat) (pORF)
ORF071276	ABM	1.0 ug DNA	EUR 506

h NFKBIA inducible lentiviral particles
LVP168	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, NFKBIA, is fully sequence verified and matched to NCBI accession ID: NM_020529.2

NFKBIA ORF Vector (Human) (pORF)
ORF007049	ABM	1.0 ug DNA	EUR 95

NFKBIA ORF Vector (Human) (pORF)
ORF007050	ABM	1.0 ug DNA	EUR 95

Nfkbia ORF Vector (Mouse) (pORF)
ORF051317	ABM	1.0 ug DNA	EUR 506

Anti-IKB alpha/NFKBIA Antibody
PB9291	BosterBio	100ug/vial	EUR 334

pECMV-Nfkbia-m-FLAG Plasmid
PVT15321	Lifescience Market	2 ug	EUR 325

Anti-Phospho-NFKBIA-S36 antibody
STJ11101107	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-Phospho-NFKBIA-(S32) antibody
STJ116373	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

Anti-Phospho-NFKBIA-(Y42) antibody
STJ22317	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.

NFKBIA ELISA Kit (Human) (OKAN04838)
OKAN04838	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL

NFKBIA ELISA Kit (Human) (OKCD07726)
OKCD07726	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: NFKB1 or NFKB2 is bound to REL, RELA, or RELB to form the NFKB complex. The NFKB complex is inhibited by I-kappa-B proteins (NFKBIA or NFKBIB), which inactivate NF-kappa-B by trapping it in the cytoplasm. Phosphorylation of serine residues on the I-kappa-B proteins by kinases (IKBKA, or IKBKB) marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B complex. Activated NFKB complex translocates into the nucleus and binds DNA at kappa-B-binding motifs such as 5-prime GGGRNNYYCC 3-prime or 5-prime HGGARNYYCC 3-prime (where H is A, C, or T; R is an A or G purine; and Y is a C or T pyrimidine).;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.065ng/mL