Mdfi

MDFI Antibody
1-CSB-PA003210	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MDFI. Recognizes MDFI from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MDFI Antibody
DF4193	Affbiotech	200ul	EUR 304
Description: MDFI Antibody detects endogenous levels of total MDFI.

MDFI antibody
70R-36982	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal MDFI antibody

MDFI siRNA
20-abx923785	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MDFI siRNA
20-abx923786	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MDFI Antibody
ABD4193	Lifescience Market	100 ug	EUR 438

anti-MDFI
YF-PA24134	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to MDFI

Anti-MDFI Antibody
A10664-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for MDFI Antibody (MDFI) detection. Tested with WB in Human, Mouse.

MDFI Rabbit pAb
A13709-100ul	Abclonal	100 ul	EUR 308

MDFI Rabbit pAb
A13709-200ul	Abclonal	200 ul	EUR 459

MDFI Rabbit pAb
A13709-20ul	Abclonal	20 ul	EUR 183

MDFI Rabbit pAb
A13709-50ul	Abclonal	50 ul	EUR 223

MDFI Blocking Peptide
DF4193-BP	Affbiotech	1mg	EUR 195

MDFI Conjugated Antibody
C47720	SAB	100ul	EUR 397

MDFI cloning plasmid
CSB-CL013617HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 741 Sequence: atgtaccaggtgagcggccagcgcccctctggctgcgacgcgccctatggagcccccagcgcagccccgggcccagcccagaccctatccctccttcctgggctggaggtagtaacaggatccactcaccctgcggaggcagcaccagaggagggctccctggaggaggcggcaac Show more
Description: A cloning plasmid for the MDFI gene.

MDFI Polyclonal Antibody
ABP51764-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160 Applications tips:
Description: A polyclonal antibody for detection of MDFI from Human, Mouse. This MDFI antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160

MDFI Polyclonal Antibody
ABP51764-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160 Applications tips:
Description: A polyclonal antibody for detection of MDFI from Human, Mouse. This MDFI antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160

MDFI Polyclonal Antibody
ABP51764-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160 Applications tips:
Description: A polyclonal antibody for detection of MDFI from Human, Mouse. This MDFI antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MDFI at AA range: 80-160

MDFI Polyclonal Antibody
ES2763-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MDFI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MDFI Polyclonal Antibody
ES2763-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MDFI from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-MDFI (3B4)
YF-MA14162	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MDFI

Anti-MDFI antibody
STJ115663	St John's Laboratory	100 µl	EUR 277
Description: This protein is a transcription factor that negatively regulates other myogenic family proteins. Studies of the mouse homolog, I-mf, show that it interferes with myogenic factor function by masking nuclear localization signals and preventing DNA binding. Knockout mouse studies show defects in the formation of vertebrae and ribs that also involve cartilage formation in these structures.

Anti-MDFI antibody
STJ94053	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MDFI.

Anti-MDFI antibody
STJ71955	St John's Laboratory	100 µg	EUR 359

Anti-MDFI antibody
STJ72203	St John's Laboratory	100 µg	EUR 260

Human MDFI shRNA Plasmid
20-abx952848	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MDFI shRNA Plasmid
20-abx971474	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MDFI Recombinant Protein (Human)
RP019036	ABM	100 ug	Ask for price

MDFI Recombinant Protein (Mouse)
RP149903	ABM	100 ug	Ask for price

MDFI Recombinant Protein (Mouse)
RP149906	ABM	100 ug	Ask for price

MDFI Recombinant Protein (Rat)
RP211190	ABM	100 ug	Ask for price

Polyclonal MDFI Antibody (internal region)
APG00602G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MDFI (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal MDFI Antibody (N-Term)
APG00665G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MDFI (N-Term). This antibody is tested and proven to work in the following applications:

MyoD Family Inhibitor (MDFI) Antibody
abx216226-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

MyoD Family Inhibitor (MDFI) Antibody
20-abx325428	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

MyoD Family Inhibitor (MDFI) Antibody
abx432954-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

MyoD Family Inhibitor (MDFI) Antibody
abx432955-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Mdfi ORF Vector (Rat) (pORF)
ORF070398	ABM	1.0 ug DNA	EUR 506

MDFI ORF Vector (Human) (pORF)
ORF006346	ABM	1.0 ug DNA	EUR 95

Mdfi ORF Vector (Mouse) (pORF)
ORF049969	ABM	1.0 ug DNA	EUR 506

Mdfi ORF Vector (Mouse) (pORF)
ORF049970	ABM	1.0 ug DNA	EUR 506

Polyclonal MDFI / I-MF Antibody (Internal)
APG01239G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MDFI / I-MF (Internal). This antibody is tested and proven to work in the following applications:

Mdfi sgRNA CRISPR Lentivector set (Mouse)
K4986601	ABM	3 x 1.0 ug	EUR 339

Mdfi sgRNA CRISPR Lentivector set (Rat)
K6679601	ABM	3 x 1.0 ug	EUR 339

MDFI sgRNA CRISPR Lentivector set (Human)
K1282601	ABM	3 x 1.0 ug	EUR 339

Mouse MyoD family inhibitor, Mdfi ELISA KIT
ELI-20464m	Lifescience Market	96 Tests	EUR 865

Human MyoD family inhibitor, MDFI ELISA KIT
ELI-46069h	Lifescience Market	96 Tests	EUR 824

Monoclonal MDFI Antibody (monoclonal) (M07), Clone: 3B4
AMM03785G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MDFI (monoclonal) (M07). The antibodies are raised in mouse and are from clone 3B4. This antibody is applicable in WB and IF

Mdfi sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4986602	ABM	1.0 ug DNA	EUR 154

Mdfi sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4986603	ABM	1.0 ug DNA	EUR 154

Mdfi sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4986604	ABM	1.0 ug DNA	EUR 154

Mdfi sgRNA CRISPR Lentivector (Rat) (Target 1)
K6679602	ABM	1.0 ug DNA	EUR 154

Mdfi sgRNA CRISPR Lentivector (Rat) (Target 2)
K6679603	ABM	1.0 ug DNA	EUR 154

Mdfi sgRNA CRISPR Lentivector (Rat) (Target 3)
K6679604	ABM	1.0 ug DNA	EUR 154

MDFI sgRNA CRISPR Lentivector (Human) (Target 1)
K1282602	ABM	1.0 ug DNA	EUR 154

MDFI sgRNA CRISPR Lentivector (Human) (Target 2)
K1282603	ABM	1.0 ug DNA	EUR 154

MDFI sgRNA CRISPR Lentivector (Human) (Target 3)
K1282604	ABM	1.0 ug DNA	EUR 154

MDFI 3'UTR Luciferase Stable Cell Line
TU013146	ABM	1.0 ml	EUR 1394

Mdfi 3'UTR Luciferase Stable Cell Line
TU113020	ABM	1.0 ml	Ask for price

Mdfi 3'UTR GFP Stable Cell Line
TU163020	ABM	1.0 ml	Ask for price

Mdfi 3'UTR Luciferase Stable Cell Line
TU212992	ABM	1.0 ml	Ask for price

Mdfi 3'UTR GFP Stable Cell Line
TU262992	ABM	1.0 ml	Ask for price

MDFI 3'UTR GFP Stable Cell Line
TU063146	ABM	1.0 ml	EUR 1394

MDFI Protein Vector (Rat) (pPB-C-His)
PV281590	ABM	500 ng	EUR 603

MDFI Protein Vector (Rat) (pPB-N-His)
PV281591	ABM	500 ng	EUR 603

MDFI Protein Vector (Rat) (pPM-C-HA)
PV281592	ABM	500 ng	EUR 603

MDFI Protein Vector (Rat) (pPM-C-His)
PV281593	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPB-C-His)
PV199874	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPB-N-His)
PV199875	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPM-C-HA)
PV199876	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPM-C-His)
PV199877	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPB-C-His)
PV199878	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPB-N-His)
PV199879	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPM-C-HA)
PV199880	ABM	500 ng	EUR 603

MDFI Protein Vector (Mouse) (pPM-C-His)
PV199881	ABM	500 ng	EUR 603

MDFI Protein Vector (Human) (pPB-C-His)
PV025381	ABM	500 ng	EUR 329

MDFI Protein Vector (Human) (pPB-N-His)
PV025382	ABM	500 ng	EUR 329

MDFI Protein Vector (Human) (pPM-C-HA)
PV025383	ABM	500 ng	EUR 329

MDFI Protein Vector (Human) (pPM-C-His)
PV025384	ABM	500 ng	EUR 329

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV622663	ABM	1.0 ug DNA	EUR 514

MDFI Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV622667	ABM	1.0 ug DNA	EUR 514

MDFI Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV622668	ABM	1.0 ug DNA	EUR 514

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4986605	ABM	3 x 1.0 ug	EUR 376

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6679605	ABM	3 x 1.0 ug	EUR 376

MDFI sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1282605	ABM	3 x 1.0 ug	EUR 376

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4986606	ABM	1.0 ug DNA	EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4986607	ABM	1.0 ug DNA	EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4986608	ABM	1.0 ug DNA	EUR 167

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV622664	ABM	1.0 ug DNA	EUR 514

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV622665	ABM	1.0 ug DNA	EUR 572

MDFI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV622666	ABM	1.0 ug DNA	EUR 572

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6679606	ABM	1.0 ug DNA	EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6679607	ABM	1.0 ug DNA	EUR 167

Mdfi sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6679608	ABM	1.0 ug DNA	EUR 167

MDFI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1282606	ABM	1.0 ug DNA	EUR 167