GNGT1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNGT1. Recognizes GNGT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNGT1 Polyclonal Antibody

29380-100ul 100ul
EUR 252

GNGT1 Polyclonal Antibody

29380-50ul 50ul
EUR 187

GNGT1 Rabbit pAb

A15675-100ul 100 ul
EUR 308

GNGT1 Rabbit pAb

A15675-200ul 200 ul
EUR 459

GNGT1 Rabbit pAb

A15675-20ul 20 ul
EUR 183

GNGT1 Rabbit pAb

A15675-50ul 50 ul
EUR 223

Human GNGT1 Antibody

33181-05111 150 ug
EUR 261

GNGT1 cloning plasmid

CSB-CL009621HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 225
  • Sequence: atgccagtaatcaatattgaggacctgacagaaaaggacaaattgaagatggaagttgaccagctcaagaaagaagtgacactggaaagaatgctagtttccaaatgttgtgaagaagtaagagattacgttgaagaacgatctggcgaggatccactggtaaagggcatcccaga
  • Show more
Description: A cloning plasmid for the GNGT1 gene.

GNGT1 Rabbit pAb

A3890-100ul 100 ul
EUR 308

GNGT1 Rabbit pAb

A3890-200ul 200 ul
EUR 459

GNGT1 Rabbit pAb

A3890-20ul 20 ul Ask for price

GNGT1 Rabbit pAb

A3890-50ul 50 ul Ask for price

anti- GNGT1 antibody

FNab03547 100µg
EUR 505.25
  • Immunogen: guanine nucleotide binding protein(G protein), gamma transducing activity polypeptide 1
  • Uniprot ID: P63211
  • Gene ID: 2792
  • Research Area: Signal Transduction
Description: Antibody raised against GNGT1

Anti-GNGT1 antibody

PAab03547 100 ug
EUR 355

Anti-GNGT1 (1F8)

YF-MA13280 100 ug
EUR 363
Description: Mouse monoclonal to GNGT1

Anti-GNGT1 antibody

STJ111201 100 µl
EUR 277

Anti-GNGT1 antibody

STJ118135 100 µl
EUR 277

GNGT1 protein (His tag)

80R-3948 100 ug
EUR 327
Description: Purified recombinant GNGT1 protein (His tag)


ELI-08150d 96 Tests
EUR 928


EF009919 96 Tests
EUR 689

GNGT1 Polyclonal Conjugated Antibody

C29380 100ul
EUR 397

Human GNGT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNGT1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gngt1 ELISA KIT

ELI-32425m 96 Tests
EUR 865


ELI-48621b 96 Tests
EUR 928


ELI-48745h 96 Tests
EUR 824

GNGT1 Recombinant Protein (Human)

RP013558 100 ug Ask for price

GNGT1 Recombinant Protein (Rat)

RP203036 100 ug Ask for price

GNGT1 Recombinant Protein (Mouse)

RP139046 100 ug Ask for price

Human GNGT1 Antibody (Biotin Conjugate)

33181-05121 150 ug
EUR 369

Polyclonal GNGT1 Antibody (C-term)

APR16189G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNGT1 (C-term). This antibody is tested and proven to work in the following applications:

Gngt1 ORF Vector (Rat) (pORF)

ORF067680 1.0 ug DNA
EUR 506

GNGT1 ORF Vector (Human) (pORF)

ORF004520 1.0 ug DNA
EUR 95

Gngt1 ORF Vector (Mouse) (pORF)

ORF046350 1.0 ug DNA
EUR 506

Human GNGT1 AssayLite Antibody (FITC Conjugate)

33181-05141 150 ug
EUR 428

Human GNGT1 AssayLite Antibody (RPE Conjugate)

33181-05151 150 ug
EUR 428

Human GNGT1 AssayLite Antibody (APC Conjugate)

33181-05161 150 ug
EUR 428

Human GNGT1 AssayLite Antibody (PerCP Conjugate)

33181-05171 150 ug
EUR 471

Gngt1 sgRNA CRISPR Lentivector set (Rat)

K6673101 3 x 1.0 ug
EUR 339

Gngt1 sgRNA CRISPR Lentivector set (Mouse)

K4376201 3 x 1.0 ug
EUR 339

GNGT1 sgRNA CRISPR Lentivector set (Human)

K0878101 3 x 1.0 ug
EUR 339

Gngt1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6673102 1.0 ug DNA
EUR 154

Gngt1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6673103 1.0 ug DNA
EUR 154

Gngt1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6673104 1.0 ug DNA
EUR 154

Gngt1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4376202 1.0 ug DNA
EUR 154

Gngt1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4376203 1.0 ug DNA
EUR 154

Gngt1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4376204 1.0 ug DNA
EUR 154

GNGT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0878102 1.0 ug DNA
EUR 154

GNGT1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0878103 1.0 ug DNA
EUR 154

GNGT1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0878104 1.0 ug DNA
EUR 154

GNGT1 3'UTR Luciferase Stable Cell Line

TU009006 1.0 ml
EUR 1521

Gngt1 3'UTR Luciferase Stable Cell Line

TU108875 1.0 ml Ask for price

Gngt1 3'UTR Luciferase Stable Cell Line

TU205234 1.0 ml Ask for price

Gngt1 3'UTR GFP Stable Cell Line

TU158875 1.0 ml Ask for price

Gngt1 3'UTR GFP Stable Cell Line

TU255234 1.0 ml Ask for price

GNGT1 3'UTR GFP Stable Cell Line

TU059006 1.0 ml
EUR 1521

GNGT1 Protein Vector (Rat) (pPB-C-His)

PV270718 500 ng
EUR 603