CCT8

CCT8 siRNA
20-abx910915	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCT8 antibody
70R-3562	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CCT8 antibody

CCT8 Antibody
ABD4561	Lifescience Market	100 ug	EUR 438

CCT8 antibody
70R-16252	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CCT8 antibody

CCT8 Antibody
DF4561	Affbiotech	200ul	EUR 304
Description: CCT8 Antibody detects endogenous levels of total CCT8.

CCT8 Antibody
1-CSB-PA004873GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CCT8 Antibody
1-CSB-PA004873LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CCT8 Antibody
1-CSB-PA006683	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

CCT8 cloning plasmid
CSB-CL004873HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1647 Sequence: atggcgcttcacgttcccaaggctccgggctttgcccagatgctcaaggagggagcgaaacacttttcaggattagaagaggctgtgtatagaaacatacaagcttgcaaggagcttgcccaaaccactcgtacagcatatggaccaaatggaatgaacaaaatggttatcaacc Show more
Description: A cloning plasmid for the CCT8 gene.

anti- CCT8 antibody
FNab01404	FN Test	100µg	EUR 505.25
Immunogen: chaperonin containing TCP1, subunit 8(theta) Uniprot ID: P50990 Gene ID: 10694 Research Area: Metabolism
Description: Antibody raised against CCT8

CCT8 Rabbit pAb
A4449-100ul	Abclonal	100 ul	EUR 308

CCT8 Rabbit pAb
A4449-200ul	Abclonal	200 ul	EUR 459

CCT8 Rabbit pAb
A4449-20ul	Abclonal	20 ul	EUR 183

CCT8 Rabbit pAb
A4449-50ul	Abclonal	50 ul	EUR 223

CCT8 Blocking Peptide
33R-2076	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCT8 antibody, catalog no. 70R-3562

CCT8 Polyclonal Antibody
30568-100ul	SAB	100ul	EUR 252

CCT8 Polyclonal Antibody
30568-50ul	SAB	50ul	EUR 187

CCT8 Blocking Peptide
DF4561-BP	Affbiotech	1mg	EUR 195

Anti-CCT8 antibody
PAab01404	Lifescience Market	100 ug	EUR 355

Anti-CCT8 antibody
STJ111219	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the theta subunit of the CCT chaperonin, which is abundant in the eukaryotic cytosol and may be involved in the transport and assembly of newly synthesized proteins. Alternative splicing results in multiple transcript variants of this gene. A pseudogene related to this gene is located on chromosome 1.

CCT8 Polyclonal Conjugated Antibody
C30568	SAB	100ul	EUR 397

CCT8 ELISA KIT|Human
EF008485	Lifescience Market	96 Tests	EUR 689

Human CCT8 shRNA Plasmid
20-abx957293	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CCT8 shRNA Plasmid
20-abx969543	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CCT8 Antibody, HRP conjugated
1-CSB-PA004873LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT8 Antibody, FITC conjugated
1-CSB-PA004873LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT8 Antibody, Biotin conjugated
1-CSB-PA004873LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT8. Recognizes CCT8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCT8 Recombinant Protein (Human)
RP006262	ABM	100 ug	Ask for price

CCT8 Recombinant Protein (Rat)
RP193829	ABM	100 ug	Ask for price

CCT8 Recombinant Protein (Mouse)
RP122324	ABM	100 ug	Ask for price

CCT8 ORF Vector (Human) (pORF)
ORF002088	ABM	1.0 ug DNA	EUR 95

Anti-TCP1 theta/CCT8 Antibody
PB9993	BosterBio	100ug/vial	EUR 334

Cct8 ORF Vector (Mouse) (pORF)
ORF040776	ABM	1.0 ug DNA	EUR 506

Cct8 ORF Vector (Rat) (pORF)
ORF064611	ABM	1.0 ug DNA	EUR 506

[One Step] CCT8 Antibody Kit
RK05632	Abclonal	50 ul	EUR 240

CCT8 ELISA Kit (Human) (OKCA00834)
OKCA00834	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. As part of the BBS/CCT complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. Known to play a role, in vitro, in the folding of actin and tubulin.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.95 pg/mL

CCT8 sgRNA CRISPR Lentivector set (Human)
K0398201	ABM	3 x 1.0 ug	EUR 339

Cct8 sgRNA CRISPR Lentivector set (Mouse)
K4940101	ABM	3 x 1.0 ug	EUR 339

Cct8 sgRNA CRISPR Lentivector set (Rat)
K6623901	ABM	3 x 1.0 ug	EUR 339

CCT8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0398202	ABM	1.0 ug DNA	EUR 154

CCT8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0398203	ABM	1.0 ug DNA	EUR 154

CCT8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0398204	ABM	1.0 ug DNA	EUR 154

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody
20-abx111569	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 8 (CCT8) Antibody
20-abx325666	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Cct8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4940102	ABM	1.0 ug DNA	EUR 154

Cct8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4940103	ABM	1.0 ug DNA	EUR 154

Cct8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4940104	ABM	1.0 ug DNA	EUR 154

Cct8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6623902	ABM	1.0 ug DNA	EUR 154

Cct8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6623903	ABM	1.0 ug DNA	EUR 154

Cct8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6623904	ABM	1.0 ug DNA	EUR 154

CCT8 Protein Vector (Human) (pPB-C-His)
PV008349	ABM	500 ng	EUR 329

CCT8 Protein Vector (Human) (pPB-N-His)
PV008350	ABM	500 ng	EUR 329

CCT8 Protein Vector (Human) (pPM-C-HA)
PV008351	ABM	500 ng	EUR 329

CCT8 Protein Vector (Human) (pPM-C-His)
PV008352	ABM	500 ng	EUR 329

CCT8 Protein Vector (Rat) (pPB-C-His)
PV258442	ABM	500 ng	EUR 603

CCT8 Protein Vector (Rat) (pPB-N-His)
PV258443	ABM	500 ng	EUR 603

CCT8 Protein Vector (Rat) (pPM-C-HA)
PV258444	ABM	500 ng	EUR 603

CCT8 Protein Vector (Rat) (pPM-C-His)
PV258445	ABM	500 ng	EUR 603

CCT8 Protein Vector (Mouse) (pPB-C-His)
PV163102	ABM	500 ng	EUR 603

CCT8 Protein Vector (Mouse) (pPB-N-His)
PV163103	ABM	500 ng	EUR 603

CCT8 Protein Vector (Mouse) (pPM-C-HA)
PV163104	ABM	500 ng	EUR 603

CCT8 Protein Vector (Mouse) (pPM-C-His)
PV163105	ABM	500 ng	EUR 603

Cct8 3'UTR Luciferase Stable Cell Line
TU201929	ABM	1.0 ml	Ask for price

Cct8 3'UTR GFP Stable Cell Line
TU153443	ABM	1.0 ml	Ask for price

CCT8 3'UTR Luciferase Stable Cell Line
TU003848	ABM	1.0 ml	EUR 1394

Cct8 3'UTR Luciferase Stable Cell Line
TU103443	ABM	1.0 ml	Ask for price

CCT8 3'UTR GFP Stable Cell Line
TU053848	ABM	1.0 ml	EUR 1394

Cct8 3'UTR GFP Stable Cell Line
TU251929	ABM	1.0 ml	Ask for price

T-Complex Protein 1 Subunit Theta (CCT8) Antibody
20-abx123913	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody
abx146227-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody
20-abx014942	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody
20-abx317869	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody
abx413784-01mg	Abbexa	0.1 mg	EUR 495
Shipped within 1 week.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody
abx231404-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

CCT8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV640417	ABM	1.0 ug DNA	EUR 682

CCT8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV640421	ABM	1.0 ug DNA	EUR 682

CCT8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV640422	ABM	1.0 ug DNA	EUR 682

Recombinant Candida Albicans CCT8 Protein (aa 1-540)
VAng-Lsx05384-inquire	Creative Biolabs	inquire	Ask for price
Description: Candida Albicans T-complex protein 1 subunit theta, recombinant protein.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody (HRP)
20-abx314071	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody (FITC)
20-abx314072	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

T-Complex Protein 1 Subunit Theta (CCT8) Antibody (Biotin)
20-abx314073	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse T complex protein 1 subunit theta(CCT8) ELISA kit
E03T0605-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse T complex protein 1 subunit theta(CCT8) ELISA kit
E03T0605-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse T complex protein 1 subunit theta(CCT8) ELISA kit
E03T0605-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T complex protein 1 subunit theta(CCT8) ELISA kit
E01T0605-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T complex protein 1 subunit theta(CCT8) ELISA kit
E01T0605-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human T complex protein 1 subunit theta(CCT8) ELISA kit
E01T0605-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T complex protein 1 subunit theta(CCT8) ELISA kit
E02T0605-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T complex protein 1 subunit theta(CCT8) ELISA kit
E02T0605-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat T complex protein 1 subunit theta(CCT8) ELISA kit
E02T0605-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat T complex protein 1 subunit theta(CCT8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.