ALG2 Antibody

36082-100ul 100ul
EUR 252

ALG2 antibody

10R-6801 100 ul
EUR 691
Description: Mouse monoclonal ALG2 antibody

ALG2 antibody

10R-6802 100 ul
EUR 726
Description: Mouse monoclonal ALG2 antibody

ALG2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALG2. Recognizes ALG2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ALG2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ALG2. Recognizes ALG2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ALG2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALG2. Recognizes ALG2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

ALG2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALG2. Recognizes ALG2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21564 50 ul
EUR 363
Description: Mouse polyclonal to ALG2


YF-PA21565 50 ug
EUR 363
Description: Mouse polyclonal to ALG2


YF-PA21566 100 ug
EUR 403
Description: Rabbit polyclonal to ALG2

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALG2, Alpha-1,3/1,6-Mannosyltransferase (ALG2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALG2, Alpha-1,3/1,6-Mannosyltransferase (ALG2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

abx036530-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

abx029375-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

abx029375-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alpha-1,3/1,6-Mannosyltransferase ALG2 (ALG2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG2, Alpha-1,3/1,6-Mannosyltransferase (ALG2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG2, Alpha-1,3/1,6-Mannosyltransferase (ALG2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG2, Alpha-1,3/1,6-Mannosyltransferase (ALG2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ALG2 Blocking Peptide

33R-7721 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ALG2 antibody, catalog no. 70R-2876

ALG2 Conjugated Antibody

C36082 100ul
EUR 397

ALG2 cloning plasmid

CSB-CL863983HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 747
  • Sequence: atggcagactgcatcttagtcaacagccagttcacagctgctgtttttaaggaaacattcaagtccctgtctcacatagaccctgatgtcctctatccatctctaaatgtcaccagctttgactcagttgttcctgaaaagctggatgacctagtccccaaggggaaaaaattcct
  • Show more
Description: A cloning plasmid for the ALG2 gene.

ALG2 cloning plasmid

CSB-CL863983HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: atggcggaggagcagggccgggaacgggactcggttcccaagccgtcggtgctgttcctccacccagacctgggcgtgggcggcgctgagcggctggtgttggacgcggcgctggcgctgcaggcgcgcgggtgtagcgtgaagatctggacagcgcactacgacccgggccact
  • Show more
Description: A cloning plasmid for the ALG2 gene.

ALG2 Rabbit pAb

A7843-100ul 100 ul
EUR 308

ALG2 Rabbit pAb

A7843-200ul 200 ul
EUR 459

ALG2 Rabbit pAb

A7843-20ul 20 ul
EUR 183

ALG2 Rabbit pAb

A7843-50ul 50 ul
EUR 223

ALG2 Rabbit pAb

A15203-100ul 100 ul
EUR 308

ALG2 Rabbit pAb

A15203-200ul 200 ul
EUR 459

ALG2 Rabbit pAb

A15203-20ul 20 ul
EUR 183

ALG2 Rabbit pAb

A15203-50ul 50 ul
EUR 223

Anti-ALG2 antibody

STJ110153 100 µl
EUR 277
Description: This gene encodes a member of the glycosyltransferase 1 family. The encoded protein acts as an alpha 1,3 mannosyltransferase, mannosylating Man(2)GlcNAc(2)-dolichol diphosphate and Man(1)GlcNAc(2)-dolichol diphosphate to form Man(3)GlcNAc(2)-dolichol diphosphate. Defects in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ii). Alternative splicing results in multiple transcript variants.

Anti-ALG2 antibody

STJ117397 100 µl
EUR 277
Description: This gene encodes a member of the glycosyltransferase 1 family. The encoded protein acts as an alpha 1,3 mannosyltransferase, mannosylating Man(2)GlcNAc(2)-dolichol diphosphate and Man(1)GlcNAc(2)-dolichol diphosphate to form Man(3)GlcNAc(2)-dolichol diphosphate. Defects in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ii). Alternative splicing results in multiple transcript variants.

Mouse Alpha- 1,3/1,6- mannosyltransferase ALG2, Alg2 ELISA KIT

ELI-24550m 96 Tests
EUR 865

Human Alpha- 1,3/1,6- mannosyltransferase ALG2, ALG2 ELISA KIT

ELI-49242h 96 Tests
EUR 824

Human Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E01A1390-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E01A1390-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E01A1390-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E02A1390-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E02A1390-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E02A1390-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E03A1390-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E03A1390-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E03A1390-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) ELISA kit

E04A1390-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha 1,3/1,6 mannosyltransferase ALG2(ALG2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.