USP30

USP30 siRNA
20-abx939211	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

USP30 antibody
70R-51139	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal USP30 antibody

USP30 antibody
70R-8855	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal USP30 antibody

USP30 Antibody
ABD4590	Lifescience Market	100 ug	EUR 438

USP30 Antibody
35119-100ul	SAB	100ul	EUR 252

USP30 Antibody
35119-50ul	SAB	50ul	EUR 187

USP30 Antibody
DF4590	Affbiotech	200ul	EUR 304
Description: USP30 Antibody detects endogenous levels of total USP30.

USP30 Antibody
1-CSB-PA004395	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

USP30 Antibody
1-CSB-PA765106LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

USP30 Antibody
CSB-PA067099-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

USP30 Antibody
CSB-PA067099-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

USP30 Conjugated Antibody
C35119	SAB	100ul	EUR 397

USP30 Polyclonal Antibody
ES3678-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against USP30 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

USP30 Polyclonal Antibody
ES3678-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against USP30 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

USP30 Blocking Peptide
20-abx064014	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

USP30 Polyclonal Antibody
ABP52679-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80 Applications tips:
Description: A polyclonal antibody for detection of USP30 from Human, Mouse, Rat. This USP30 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80

USP30 Polyclonal Antibody
ABP52679-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80 Applications tips:
Description: A polyclonal antibody for detection of USP30 from Human, Mouse, Rat. This USP30 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80

USP30 Polyclonal Antibody
ABP52679-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80 Applications tips:
Description: A polyclonal antibody for detection of USP30 from Human, Mouse, Rat. This USP30 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80

USP30 Antibody (HRP)
20-abx308158	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP30 Antibody (FITC)
20-abx308159	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP30 Antibody (Biotin)
20-abx308160	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-USP30 Antibody
A06403	BosterBio	100ul/vial	EUR 433
Description: Rabbit Polyclonal USP30 Antibody. Validated in WB and tested in Human.

Anti-USP30 Antibody
A06403-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for USP30 Antibody (USP30) detection. Tested with WB in Human, Mouse, Rat.

USP30 Rabbit pAb
A12862-100ul	Abclonal	100 ul	EUR 308

USP30 Rabbit pAb
A12862-200ul	Abclonal	200 ul	EUR 459

USP30 Rabbit pAb
A12862-20ul	Abclonal	20 ul	EUR 183

USP30 Rabbit pAb
A12862-50ul	Abclonal	50 ul	EUR 223

USP30 Polyclonal Antibody
A61694	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

USP30 Blocking Peptide
33R-8332	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP30 antibody, catalog no. 70R-8855

USP30 Blocking Peptide
DF4590-BP	Affbiotech	1mg	EUR 195

USP30 cloning plasmid
CSB-CL765106HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1527 Sequence: atgaccgcggccgacagggccatccagcgcttcctgcggaccggggcggccgtcagatataaagtcatgaagaactggggagttataggtggaattgctgctgctcttgcagcaggaatatatgttatttggggtcccattacagaaagaaagaagcgtagaaaagggcttgtgc Show more
Description: A cloning plasmid for the USP30 gene.

pDONR223-USP30 Plasmid
PVTB00928	Lifescience Market	2 ug	EUR 356

Anti-USP30 antibody
STJ96199	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to USP30.

Anti-USP30 antibody
STJ114728	St John's Laboratory	100 µl	EUR 277

Mouse USP30 shRNA Plasmid
20-abx979463	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human USP30 shRNA Plasmid
20-abx963608	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

USP30 Antibody, HRP conjugated
1-CSB-PA765106LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

USP30 Antibody, FITC conjugated
1-CSB-PA765106LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

USP30 Antibody, Biotin conjugated
1-CSB-PA765106LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

USP30 Recombinant Protein (Human)
RP034111	ABM	100 ug	Ask for price

USP30 Recombinant Protein (Rat)
RP236084	ABM	100 ug	Ask for price

USP30 Recombinant Protein (Mouse)
RP183404	ABM	100 ug	Ask for price

USP30 Polyclonal Antibody, Biotin Conjugated
A61695	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

USP30 Polyclonal Antibody, FITC Conjugated
A61696	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

USP30 Polyclonal Antibody, HRP Conjugated
A61697	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Usp30 ORF Vector (Rat) (pORF)
ORF078696	ABM	1.0 ug DNA	EUR 506

USP30 ORF Vector (Human) (pORF)
ORF011371	ABM	1.0 ug DNA	EUR 95

Usp30 ORF Vector (Mouse) (pORF)
ORF061136	ABM	1.0 ug DNA	EUR 506

pECMV-Usp30-m-FLAG Plasmid
PVT15670	Lifescience Market	2 ug	EUR 325

Ubiquitin Specific Peptidase 30 (USP30) Antibody
abx036191-100ug	Abbexa	100 ug	EUR 356
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 30 (USP30) Antibody
20-abx008001	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 30 (USP30) Antibody
20-abx014975	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 30 (USP30) Antibody
20-abx327345	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 30 (USP30) Antibody
abx331878-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Ubiquitin Specific Peptidase 30 (USP30) Antibody
20-abx318386	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

USP30 sgRNA CRISPR Lentivector set (Human)
K2599901	ABM	3 x 1.0 ug	EUR 339

Usp30 sgRNA CRISPR Lentivector set (Mouse)
K3455601	ABM	3 x 1.0 ug	EUR 339

Usp30 sgRNA CRISPR Lentivector set (Rat)
K6249001	ABM	3 x 1.0 ug	EUR 339

USP30 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599902	ABM	1.0 ug DNA	EUR 154

USP30 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599903	ABM	1.0 ug DNA	EUR 154

USP30 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599904	ABM	1.0 ug DNA	EUR 154

Usp30 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3455602	ABM	1.0 ug DNA	EUR 154

Usp30 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3455603	ABM	1.0 ug DNA	EUR 154

Usp30 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3455604	ABM	1.0 ug DNA	EUR 154

Usp30 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6249002	ABM	1.0 ug DNA	EUR 154

Usp30 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6249003	ABM	1.0 ug DNA	EUR 154

Usp30 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6249004	ABM	1.0 ug DNA	EUR 154

USP30 Protein Vector (Human) (pPB-C-His)
PV045481	ABM	500 ng	EUR 329

USP30 Protein Vector (Human) (pPB-N-His)
PV045482	ABM	500 ng	EUR 329

USP30 Protein Vector (Human) (pPM-C-HA)
PV045483	ABM	500 ng	EUR 329

USP30 Protein Vector (Human) (pPM-C-His)
PV045484	ABM	500 ng	EUR 329

USP30 Protein Vector (Rat) (pPB-C-His)
PV314782	ABM	500 ng	EUR 603

USP30 Protein Vector (Rat) (pPB-N-His)
PV314783	ABM	500 ng	EUR 603

USP30 Protein Vector (Rat) (pPM-C-HA)
PV314784	ABM	500 ng	EUR 603

USP30 Protein Vector (Rat) (pPM-C-His)
PV314785	ABM	500 ng	EUR 603