  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP30 antibody
70R-51139 100 ul
EUR 244
Description: Purified Polyclonal USP30 antibody
USP30 antibody
70R-8855 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal USP30 antibody
USP30 Antibody
ABD4590 100 ug
EUR 438
USP30 Antibody
35119-100ul 100ul
EUR 252
USP30 Antibody
35119-50ul 50ul
EUR 187
USP30 Antibody
DF4590 200ul
EUR 304
Description: USP30 Antibody detects endogenous levels of total USP30.
USP30 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
USP30 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
USP30 Antibody
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
USP30 Antibody
CSB-PA067099-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
USP30 Conjugated Antibody
C35119 100ul
EUR 397
USP30 Polyclonal Antibody
ES3678-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against USP30 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
USP30 Polyclonal Antibody
ES3678-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against USP30 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
USP30 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
USP30 Polyclonal Antibody
ABP52679-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of USP30 from Human, Mouse, Rat. This USP30 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80
USP30 Polyclonal Antibody
ABP52679-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of USP30 from Human, Mouse, Rat. This USP30 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80
USP30 Polyclonal Antibody
ABP52679-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of USP30 from Human, Mouse, Rat. This USP30 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human USP30 at AA range: 1-80
USP30 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP30 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP30 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-USP30 Antibody
A06403 100ul/vial
EUR 433
Description: Rabbit Polyclonal USP30 Antibody. Validated in WB and tested in Human.
Anti-USP30 Antibody
A06403-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for USP30 Antibody (USP30) detection. Tested with WB in Human, Mouse, Rat.
USP30 Rabbit pAb
A12862-100ul 100 ul
EUR 308
USP30 Rabbit pAb
A12862-200ul 200 ul
EUR 459
USP30 Rabbit pAb
A12862-20ul 20 ul
EUR 183
USP30 Rabbit pAb
A12862-50ul 50 ul
EUR 223
USP30 Polyclonal Antibody
A61694 100 µg
EUR 570.55
Description: kits suitable for this type of research
USP30 Blocking Peptide
33R-8332 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of USP30 antibody, catalog no. 70R-8855
USP30 Blocking Peptide
DF4590-BP 1mg
EUR 195
USP30 cloning plasmid
CSB-CL765106HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1527
  • Sequence: atgaccgcggccgacagggccatccagcgcttcctgcggaccggggcggccgtcagatataaagtcatgaagaactggggagttataggtggaattgctgctgctcttgcagcaggaatatatgttatttggggtcccattacagaaagaaagaagcgtagaaaagggcttgtgc
  • Show more
Description: A cloning plasmid for the USP30 gene.
pDONR223-USP30 Plasmid
PVTB00928 2 ug
EUR 356
Anti-USP30 antibody
STJ96199 200 µl
EUR 197
Description: Rabbit polyclonal to USP30.
Anti-USP30 antibody
STJ114728 100 µl
EUR 277
Mouse USP30 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human USP30 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP30 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP30 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP30 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP30. Recognizes USP30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
USP30 Recombinant Protein (Human)
RP034111 100 ug Ask for price
USP30 Recombinant Protein (Rat)
RP236084 100 ug Ask for price
USP30 Recombinant Protein (Mouse)
RP183404 100 ug Ask for price
USP30 Polyclonal Antibody, Biotin Conjugated
A61695 100 µg
EUR 570.55
Description: fast delivery possible
USP30 Polyclonal Antibody, FITC Conjugated
A61696 100 µg
EUR 570.55
Description: reagents widely cited
USP30 Polyclonal Antibody, HRP Conjugated
A61697 100 µg
EUR 570.55
Description: Ask the seller for details
Usp30 ORF Vector (Rat) (pORF)
ORF078696 1.0 ug DNA
EUR 506
USP30 ORF Vector (Human) (pORF)
ORF011371 1.0 ug DNA
EUR 95
Usp30 ORF Vector (Mouse) (pORF)
ORF061136 1.0 ug DNA
EUR 506
pECMV-Usp30-m-FLAG Plasmid
PVT15670 2 ug
EUR 325
Ubiquitin Specific Peptidase 30 (USP30) Antibody
abx036191-100ug 100 ug
EUR 356
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 30 (USP30) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 30 (USP30) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 30 (USP30) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 30 (USP30) Antibody
abx331878-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Ubiquitin Specific Peptidase 30 (USP30) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
USP30 sgRNA CRISPR Lentivector set (Human)
K2599901 3 x 1.0 ug
EUR 339
Usp30 sgRNA CRISPR Lentivector set (Mouse)
K3455601 3 x 1.0 ug
EUR 339
Usp30 sgRNA CRISPR Lentivector set (Rat)
K6249001 3 x 1.0 ug
EUR 339
USP30 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599902 1.0 ug DNA
EUR 154
USP30 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599903 1.0 ug DNA
EUR 154
USP30 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599904 1.0 ug DNA
EUR 154
Usp30 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3455602 1.0 ug DNA
EUR 154
Usp30 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3455603 1.0 ug DNA
EUR 154
Usp30 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3455604 1.0 ug DNA
EUR 154
Usp30 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6249002 1.0 ug DNA
EUR 154
Usp30 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6249003 1.0 ug DNA
EUR 154
Usp30 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6249004 1.0 ug DNA
EUR 154
USP30 Protein Vector (Human) (pPB-C-His)
PV045481 500 ng
EUR 329
USP30 Protein Vector (Human) (pPB-N-His)
PV045482 500 ng
EUR 329
USP30 Protein Vector (Human) (pPM-C-HA)
PV045483 500 ng
EUR 329
USP30 Protein Vector (Human) (pPM-C-His)
PV045484 500 ng
EUR 329
USP30 Protein Vector (Rat) (pPB-C-His)
PV314782 500 ng
EUR 603
USP30 Protein Vector (Rat) (pPB-N-His)
PV314783 500 ng
EUR 603
USP30 Protein Vector (Rat) (pPM-C-HA)
PV314784 500 ng
EUR 603
USP30 Protein Vector (Rat) (pPM-C-His)
PV314785 500 ng
EUR 603