UBE2W Antibody
43601-100ul 100ul
EUR 252
UBE2W Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is Unconjugated. Tested in the following application: ELISA
UBE2W Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA26320 50 ul
EUR 334
Description: Mouse polyclonal to UBE2W
UBE2W Conjugated Antibody
C43601 100ul
EUR 397
UBE2W cloning plasmid
CSB-CL842638HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atggcgtcaatgcagaaacgactacagaaagaactgttggctttgcaaaatgacccacctcctggaatgaccttaaatgagaagagtgttcaaaattcaattacacagtggattgtagacatggaaggtgcaccaggtaccttatatgaaggggaaaaatttcaacttctatttaa
  • Show more
Description: A cloning plasmid for the UBE2W gene.
UBE2W cloning plasmid
CSB-CL842638HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 480
  • Sequence: atggcgtcaatgcagaaacgactacagaaagaactgttggctttgcaaaatgacccatctcctggaatgaccttaaatgagaagagtgctcaaaattcaattacacagtggattgtagacatggaaagtgcaccaggtaccttatatgaaggggaaaaatttcaacttctatttaa
  • Show more
Description: A cloning plasmid for the UBE2W gene.
UBE2W Rabbit pAb
A4822-100ul 100 ul
EUR 308
UBE2W Rabbit pAb
A4822-200ul 200 ul
EUR 459
UBE2W Rabbit pAb
A4822-20ul 20 ul Ask for price
UBE2W Rabbit pAb
A4822-50ul 50 ul Ask for price
UBE2W Polyclonal Antibody
A55930 100 µg
EUR 570.55
Description: reagents widely cited
UBE2W Rabbit pAb
A16691-100ul 100 ul
EUR 308
UBE2W Rabbit pAb
A16691-200ul 200 ul
EUR 459
UBE2W Rabbit pAb
A16691-20ul 20 ul
EUR 183
UBE2W Rabbit pAb
A16691-50ul 50 ul
EUR 223
UBE2W Polyclonal Antibody
ABP60825-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2W from Human, Mouse, Rat. This UBE2W antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170
UBE2W Polyclonal Antibody
ABP60825-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2W from Human, Mouse, Rat. This UBE2W antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170
UBE2W Polyclonal Antibody
ABP60825-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2W from Human, Mouse, Rat. This UBE2W antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170
UBE2W Polyclonal Antibody
ES10051-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UBE2W from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
UBE2W Polyclonal Antibody
ES10051-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2W from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-UBE2W antibody
STJ111232 100 µl
EUR 277
Description: This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants.
Anti-UBE2W antibody
STJ119115 100 µl
EUR 277
Anti-UBE2W antibody
STJ191209 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2W
Anti-UBE2W (7G4)
YF-MA18762 100 ug
EUR 363
Description: Mouse monoclonal to UBE2W
UBE2W Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBE2W Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBE2W Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
UBE2W protein (His tag)
80R-1835 100 ug
EUR 349
Description: Purified recombinant UBE2W protein
ELI-28817h 96 Tests
EUR 824
Mouse Ube2w ELISA KIT
ELI-51306m 96 Tests
EUR 865
Mouse UBE2W shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UBE2W shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UBE2W Recombinant Protein (Human)
RP033766 100 ug Ask for price
UBE2W Recombinant Protein (Human)
RP033769 100 ug Ask for price
UBE2W Recombinant Protein (Mouse)
RP182741 100 ug Ask for price
Polyclonal UBE2W Antibody (C-term)
APR03844G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2W (C-term). This antibody is tested and proven to work in the following applications:
UBE2W Polyclonal Antibody, HRP Conjugated
A55931 100 µg
EUR 570.55
Description: Ask the seller for details
UBE2W Polyclonal Antibody, FITC Conjugated
A55932 100 µg
EUR 570.55
Description: The best epigenetics products
UBE2W Polyclonal Antibody, Biotin Conjugated
A55933 100 µg
EUR 570.55
Description: kits suitable for this type of research
UBE2W ORF Vector (Human) (pORF)
ORF011256 1.0 ug DNA
EUR 95
UBE2W ORF Vector (Human) (pORF)
ORF011257 1.0 ug DNA
EUR 95
Ube2w ORF Vector (Mouse) (pORF)
ORF060915 1.0 ug DNA
EUR 506
Ube2w sgRNA CRISPR Lentivector set (Mouse)
K4915401 3 x 1.0 ug
EUR 339
UBE2W sgRNA CRISPR Lentivector set (Human)
K2575201 3 x 1.0 ug
EUR 339
Human Ubiquitin-conjugating enzyme E2 W (UBE2W)
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 33.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-conjugating enzyme E2 W(UBE2W) expressed in E.coli
Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
abx027497-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
abx027497-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ube2w sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4915402 1.0 ug DNA
EUR 154
Ube2w sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4915403 1.0 ug DNA
EUR 154
Ube2w sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4915404 1.0 ug DNA
EUR 154
UBE2W sgRNA CRISPR Lentivector (Human) (Target 1)
K2575202 1.0 ug DNA
EUR 154
UBE2W sgRNA CRISPR Lentivector (Human) (Target 2)
K2575203 1.0 ug DNA
EUR 154
UBE2W sgRNA CRISPR Lentivector (Human) (Target 3)
K2575204 1.0 ug DNA
EUR 154
UBE2W Protein Vector (Mouse) (pPB-C-His)
PV243658 500 ng
EUR 603
UBE2W Protein Vector (Mouse) (pPB-N-His)
PV243659 500 ng
EUR 603
UBE2W Protein Vector (Mouse) (pPM-C-HA)
PV243660 500 ng
EUR 603
UBE2W Protein Vector (Mouse) (pPM-C-His)
PV243661 500 ng
EUR 603
UBE2W Protein Vector (Human) (pPB-C-His)
PV045021 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPB-N-His)
PV045022 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPM-C-HA)
PV045023 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPM-C-His)
PV045024 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPB-C-His)
PV045025 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPB-N-His)
PV045026 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPM-C-HA)
PV045027 500 ng
EUR 329
UBE2W Protein Vector (Human) (pPM-C-His)
PV045028 500 ng
EUR 329
Ube2w 3'UTR Luciferase Stable Cell Line
TU121480 1.0 ml Ask for price
UBE2W 3'UTR GFP Stable Cell Line
TU077696 1.0 ml
EUR 4617
Ube2w 3'UTR GFP Stable Cell Line
TU171480 1.0 ml Ask for price
UBE2W 3'UTR Luciferase Stable Cell Line
TU027696 1.0 ml
EUR 4617
UBE2W Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV716571 1.0 ug DNA
EUR 316