UBE2W

UBE2W siRNA
20-abx938820	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UBE2W antibody
70R-21118	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UBE2W antibody

UBE2W Antibody
43601-100ul	SAB	100ul	EUR 252

UBE2W Antibody
1-CSB-PA842638LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is Unconjugated. Tested in the following application: ELISA

UBE2W Antibody
1-CSB-PA025485GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-UBE2W
YF-PA26320	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to UBE2W

UBE2W Conjugated Antibody
C43601	SAB	100ul	EUR 397

UBE2W Polyclonal Antibody
ES10051-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against UBE2W from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

UBE2W Polyclonal Antibody
ES10051-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against UBE2W from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

UBE2W Polyclonal Antibody
ABP60825-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of UBE2W from Human, Mouse, Rat. This UBE2W antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170

UBE2W Polyclonal Antibody
ABP60825-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of UBE2W from Human, Mouse, Rat. This UBE2W antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170

UBE2W Polyclonal Antibody
ABP60825-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of UBE2W from Human, Mouse, Rat. This UBE2W antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2W protein at amino acid sequence of 90-170

UBE2W Rabbit pAb
A4822-100ul	Abclonal	100 ul	EUR 308

UBE2W Rabbit pAb
A4822-200ul	Abclonal	200 ul	EUR 459

UBE2W Rabbit pAb
A4822-20ul	Abclonal	20 ul	Ask for price

UBE2W Rabbit pAb
A4822-50ul	Abclonal	50 ul	Ask for price

UBE2W Polyclonal Antibody
A55930	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

UBE2W Rabbit pAb
A16691-100ul	Abclonal	100 ul	EUR 308

UBE2W Rabbit pAb
A16691-200ul	Abclonal	200 ul	EUR 459

UBE2W Rabbit pAb
A16691-20ul	Abclonal	20 ul	EUR 183

UBE2W Rabbit pAb
A16691-50ul	Abclonal	50 ul	EUR 223

UBE2W cloning plasmid
CSB-CL842638HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 456 Sequence: atggcgtcaatgcagaaacgactacagaaagaactgttggctttgcaaaatgacccacctcctggaatgaccttaaatgagaagagtgttcaaaattcaattacacagtggattgtagacatggaaggtgcaccaggtaccttatatgaaggggaaaaatttcaacttctatttaa Show more
Description: A cloning plasmid for the UBE2W gene.

UBE2W cloning plasmid
CSB-CL842638HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 480 Sequence: atggcgtcaatgcagaaacgactacagaaagaactgttggctttgcaaaatgacccatctcctggaatgaccttaaatgagaagagtgctcaaaattcaattacacagtggattgtagacatggaaagtgcaccaggtaccttatatgaaggggaaaaatttcaacttctatttaa Show more
Description: A cloning plasmid for the UBE2W gene.

Anti-UBE2W antibody
STJ111232	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants.

Anti-UBE2W antibody
STJ119115	St John's Laboratory	100 µl	EUR 277

Anti-UBE2W antibody
STJ191209	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2W

Anti-UBE2W (7G4)
YF-MA18762	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to UBE2W

Mouse UBE2W shRNA Plasmid
20-abx975787	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UBE2W ELISA KIT
ELI-28817h	Lifescience Market	96 Tests	EUR 824

Mouse Ube2w ELISA KIT
ELI-51306m	Lifescience Market	96 Tests	EUR 865

UBE2W protein (His tag)
80R-1835	Fitzgerald	100 ug	EUR 349
Description: Purified recombinant UBE2W protein

Human UBE2W shRNA Plasmid
20-abx960623	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UBE2W Antibody, HRP conjugated
1-CSB-PA842638LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBE2W Antibody, FITC conjugated
1-CSB-PA842638LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBE2W Antibody, Biotin conjugated
1-CSB-PA842638LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2W. Recognizes UBE2W from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBE2W Recombinant Protein (Human)
RP033766	ABM	100 ug	Ask for price

UBE2W Recombinant Protein (Human)
RP033769	ABM	100 ug	Ask for price

UBE2W Recombinant Protein (Mouse)
RP182741	ABM	100 ug	Ask for price

Polyclonal UBE2W Antibody (C-term)
APR03844G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2W (C-term). This antibody is tested and proven to work in the following applications:

UBE2W Polyclonal Antibody, HRP Conjugated
A55931	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

UBE2W Polyclonal Antibody, FITC Conjugated
A55932	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

UBE2W Polyclonal Antibody, Biotin Conjugated
A55933	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

UBE2W ORF Vector (Human) (pORF)
ORF011256	ABM	1.0 ug DNA	EUR 95

UBE2W ORF Vector (Human) (pORF)
ORF011257	ABM	1.0 ug DNA	EUR 95

Ube2w ORF Vector (Mouse) (pORF)
ORF060915	ABM	1.0 ug DNA	EUR 506

UBE2W sgRNA CRISPR Lentivector set (Human)
K2575201	ABM	3 x 1.0 ug	EUR 339

Ube2w sgRNA CRISPR Lentivector set (Mouse)
K4915401	ABM	3 x 1.0 ug	EUR 339

Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
20-abx127073	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
20-abx109392	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
abx027497-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Ubiquitin-Conjugating Enzyme E2 W (UBE2W) Antibody
abx027497-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

UBE2W sgRNA CRISPR Lentivector (Human) (Target 1)
K2575202	ABM	1.0 ug DNA	EUR 154

UBE2W sgRNA CRISPR Lentivector (Human) (Target 2)
K2575203	ABM	1.0 ug DNA	EUR 154

UBE2W sgRNA CRISPR Lentivector (Human) (Target 3)
K2575204	ABM	1.0 ug DNA	EUR 154

Human Ubiquitin-conjugating enzyme E2 W (UBE2W)
1-CSB-EP842638HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 33.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-conjugating enzyme E2 W(UBE2W) expressed in E.coli

Ube2w sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4915402	ABM	1.0 ug DNA	EUR 154

Ube2w sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4915403	ABM	1.0 ug DNA	EUR 154

Ube2w sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4915404	ABM	1.0 ug DNA	EUR 154

UBE2W Protein Vector (Human) (pPB-C-His)
PV045021	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPB-N-His)
PV045022	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPM-C-HA)
PV045023	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPM-C-His)
PV045024	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPB-C-His)
PV045025	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPB-N-His)
PV045026	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPM-C-HA)
PV045027	ABM	500 ng	EUR 329

UBE2W Protein Vector (Human) (pPM-C-His)
PV045028	ABM	500 ng	EUR 329

UBE2W Protein Vector (Mouse) (pPB-C-His)
PV243658	ABM	500 ng	EUR 603

UBE2W Protein Vector (Mouse) (pPB-N-His)
PV243659	ABM	500 ng	EUR 603

UBE2W Protein Vector (Mouse) (pPM-C-HA)
PV243660	ABM	500 ng	EUR 603

UBE2W Protein Vector (Mouse) (pPM-C-His)
PV243661	ABM	500 ng	EUR 603

Ube2w 3'UTR GFP Stable Cell Line
TU171480	ABM	1.0 ml	Ask for price

UBE2W 3'UTR GFP Stable Cell Line
TU077696	ABM	1.0 ml	EUR 4617

Ube2w 3'UTR Luciferase Stable Cell Line
TU121480	ABM	1.0 ml	Ask for price

UBE2W 3'UTR Luciferase Stable Cell Line
TU027696	ABM	1.0 ml	EUR 4617

UBE2W Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV716571	ABM	1.0 ug DNA	EUR 316