TADA2B

TADA2B Antibody
1-CSB-PA768204LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti- TADA2B antibody
FNab08474	FN Test	100µg	EUR 585
Immunogen: transcriptional adaptor 2(ADA2 homolog, yeast)-beta Uniprot ID: Q86TJ2 Gene ID: 93624 Research Area: Metabolism
Description: Antibody raised against TADA2B

TADA2B Polyclonal Antibody
A65754	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TADA2B cloning plasmid
CSB-CL768204HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 987 Sequence: ATGGCTGCCCACGTTGGTGCTTCCCGGACTCCCCAAGAGGTGATGGAGCATTACGTGAGCATGTACATCCACGGGAACCTGGGGAAGGCCTGCATCCCCGACACCATCCCCAACCGCGTGACAGACCACACCTGTCCCAGCGGAGGCCCCCTCTCACCCAGCCTCACCACCCCGCT Show more
Description: A cloning plasmid for the TADA2B gene.

Anti-TADA2B antibody
PAab08474	Lifescience Market	100 ug	EUR 412

Human TADA2B shRNA Plasmid
20-abx964218	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TADA2B ELISA KIT|Human
EF003428	Lifescience Market	96 Tests	EUR 689

TADA2B Antibody, HRP conjugated
1-CSB-PA768204LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TADA2B Antibody, FITC conjugated
1-CSB-PA768204LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TADA2B Antibody, Biotin conjugated
1-CSB-PA768204LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TADA2B Recombinant Protein (Human)
RP100902	ABM	100 ug	Ask for price

TADA2B Recombinant Protein (Rat)
RP232133	ABM	100 ug	Ask for price

TADA2B Recombinant Protein (Mouse)
RP177065	ABM	100 ug	Ask for price

Transcriptional Adaptor 2B (TADA2B) Antibody
20-abx308190	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transcriptional Adaptor 2B (TADA2B) Antibody
abx238474-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

TADA2B Polyclonal Antibody, HRP Conjugated
A65755	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TADA2B Polyclonal Antibody, FITC Conjugated
A65756	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TADA2B Polyclonal Antibody, Biotin Conjugated
A65757	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TADA2B ORF Vector (Human) (pORF)
ORF033635	ABM	1.0 ug DNA	Ask for price

Tada2b ORF Vector (Mouse) (pORF)
ORF059023	ABM	1.0 ug DNA	EUR 506

Tada2b ORF Vector (Rat) (pORF)
ORF077379	ABM	1.0 ug DNA	EUR 506

Transcriptional Adaptor 2B (TADA2B) Antibody (HRP)
20-abx308191	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transcriptional Adaptor 2B (TADA2B) Antibody (FITC)
20-abx308192	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transcriptional Adaptor 2B (TADA2B) Antibody (Biotin)
20-abx308193	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TADA2B sgRNA CRISPR Lentivector set (Human)
K2810101	ABM	3 x 1.0 ug	EUR 339

Tada2b sgRNA CRISPR Lentivector set (Mouse)
K3129101	ABM	3 x 1.0 ug	EUR 339

Tada2b sgRNA CRISPR Lentivector set (Rat)
K7216401	ABM	3 x 1.0 ug	EUR 339

Human Transcriptional Adaptor 2B (TADA2B) ELISA Kit
abx383614-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TADA2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2810102	ABM	1.0 ug DNA	EUR 154

TADA2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2810103	ABM	1.0 ug DNA	EUR 154

TADA2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2810104	ABM	1.0 ug DNA	EUR 154

Tada2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3129102	ABM	1.0 ug DNA	EUR 154

Tada2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3129103	ABM	1.0 ug DNA	EUR 154

Tada2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3129104	ABM	1.0 ug DNA	EUR 154

Tada2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7216402	ABM	1.0 ug DNA	EUR 154

Tada2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7216403	ABM	1.0 ug DNA	EUR 154

Tada2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7216404	ABM	1.0 ug DNA	EUR 154

TADA2B Protein Vector (Human) (pPB-C-His)
PV134538	ABM	500 ng	Ask for price

TADA2B Protein Vector (Human) (pPB-N-His)
PV134539	ABM	500 ng	Ask for price

TADA2B Protein Vector (Human) (pPM-C-HA)
PV134540	ABM	500 ng	Ask for price

TADA2B Protein Vector (Human) (pPM-C-His)
PV134541	ABM	500 ng	Ask for price

TADA2B Protein Vector (Rat) (pPB-C-His)
PV309514	ABM	500 ng	EUR 603

TADA2B Protein Vector (Rat) (pPB-N-His)
PV309515	ABM	500 ng	EUR 603

TADA2B Protein Vector (Rat) (pPM-C-HA)
PV309516	ABM	500 ng	EUR 603

TADA2B Protein Vector (Rat) (pPM-C-His)
PV309517	ABM	500 ng	EUR 603

TADA2B Protein Vector (Mouse) (pPB-C-His)
PV236090	ABM	500 ng	EUR 603

TADA2B Protein Vector (Mouse) (pPB-N-His)
PV236091	ABM	500 ng	EUR 603

TADA2B Protein Vector (Mouse) (pPM-C-HA)
PV236092	ABM	500 ng	EUR 603

TADA2B Protein Vector (Mouse) (pPM-C-His)
PV236093	ABM	500 ng	EUR 603

Tada2b 3'UTR GFP Stable Cell Line
TU170091	ABM	1.0 ml	Ask for price

Tada2b 3'UTR Luciferase Stable Cell Line
TU120091	ABM	1.0 ml	Ask for price

TADA2B 3'UTR GFP Stable Cell Line
TU075072	ABM	1.0 ml	EUR 2333

TADA2B 3'UTR Luciferase Stable Cell Line
TU025072	ABM	1.0 ml	EUR 2333

Tada2b 3'UTR Luciferase Stable Cell Line
TU221535	ABM	1.0 ml	Ask for price

Tada2b 3'UTR GFP Stable Cell Line
TU271535	ABM	1.0 ml	Ask for price

Human Transcriptional adapter 2- beta, TADA2B ELISA KIT
ELI-46305h	Lifescience Market	96 Tests	EUR 824

TADA2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629539	ABM	1.0 ug DNA	EUR 682

TADA2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629543	ABM	1.0 ug DNA	EUR 682

TADA2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629544	ABM	1.0 ug DNA	EUR 682

TADA2B Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV803913	ABM	1.0 ug DNA	EUR 572

TADA2B Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV803917	ABM	1.0 ug DNA	EUR 572

TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2810105	ABM	3 x 1.0 ug	EUR 376

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3129105	ABM	3 x 1.0 ug	EUR 376

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7216405	ABM	3 x 1.0 ug	EUR 376

TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2810106	ABM	1.0 ug DNA	EUR 167

TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2810107	ABM	1.0 ug DNA	EUR 167

TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2810108	ABM	1.0 ug DNA	EUR 167

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3129106	ABM	1.0 ug DNA	EUR 167

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3129107	ABM	1.0 ug DNA	EUR 167

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3129108	ABM	1.0 ug DNA	EUR 167

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7216406	ABM	1.0 ug DNA	EUR 167

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7216407	ABM	1.0 ug DNA	EUR 167

Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7216408	ABM	1.0 ug DNA	EUR 167

TADA2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV629540	ABM	1.0 ug DNA	EUR 682

TADA2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV629541	ABM	1.0 ug DNA	EUR 740