TADA2B

TADA2B Antibody
1-CSB-PA768204LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
anti- TADA2B antibody
FNab08474 100µg
EUR 585
  • Immunogen: transcriptional adaptor 2(ADA2 homolog, yeast)-beta
  • Uniprot ID: Q86TJ2
  • Gene ID: 93624
  • Research Area: Metabolism
Description: Antibody raised against TADA2B
TADA2B Polyclonal Antibody
A65754 100 µg
EUR 570.55
Description: reagents widely cited
TADA2B cloning plasmid
CSB-CL768204HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 987
  • Sequence: ATGGCTGCCCACGTTGGTGCTTCCCGGACTCCCCAAGAGGTGATGGAGCATTACGTGAGCATGTACATCCACGGGAACCTGGGGAAGGCCTGCATCCCCGACACCATCCCCAACCGCGTGACAGACCACACCTGTCCCAGCGGAGGCCCCCTCTCACCCAGCCTCACCACCCCGCT
  • Show more
Description: A cloning plasmid for the TADA2B gene.
Anti-TADA2B antibody
PAab08474 100 ug
EUR 412
Human TADA2B shRNA Plasmid
20-abx964218
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TADA2B ELISA KIT|Human
EF003428 96 Tests
EUR 689
TADA2B Antibody, HRP conjugated
1-CSB-PA768204LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TADA2B Antibody, FITC conjugated
1-CSB-PA768204LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TADA2B Antibody, Biotin conjugated
1-CSB-PA768204LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TADA2B. Recognizes TADA2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TADA2B Recombinant Protein (Human)
RP100902 100 ug Ask for price
TADA2B Recombinant Protein (Rat)
RP232133 100 ug Ask for price
TADA2B Recombinant Protein (Mouse)
RP177065 100 ug Ask for price
Transcriptional Adaptor 2B (TADA2B) Antibody
20-abx308190
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transcriptional Adaptor 2B (TADA2B) Antibody
abx238474-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
TADA2B Polyclonal Antibody, HRP Conjugated
A65755 100 µg
EUR 570.55
Description: Ask the seller for details
TADA2B Polyclonal Antibody, FITC Conjugated
A65756 100 µg
EUR 570.55
Description: The best epigenetics products
TADA2B Polyclonal Antibody, Biotin Conjugated
A65757 100 µg
EUR 570.55
Description: kits suitable for this type of research
TADA2B ORF Vector (Human) (pORF)
ORF033635 1.0 ug DNA Ask for price
Tada2b ORF Vector (Mouse) (pORF)
ORF059023 1.0 ug DNA
EUR 506
Tada2b ORF Vector (Rat) (pORF)
ORF077379 1.0 ug DNA
EUR 506
Transcriptional Adaptor 2B (TADA2B) Antibody (HRP)
20-abx308191
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transcriptional Adaptor 2B (TADA2B) Antibody (FITC)
20-abx308192
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Transcriptional Adaptor 2B (TADA2B) Antibody (Biotin)
20-abx308193
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TADA2B sgRNA CRISPR Lentivector set (Human)
K2810101 3 x 1.0 ug
EUR 339
Tada2b sgRNA CRISPR Lentivector set (Mouse)
K3129101 3 x 1.0 ug
EUR 339
Tada2b sgRNA CRISPR Lentivector set (Rat)
K7216401 3 x 1.0 ug
EUR 339
Human Transcriptional Adaptor 2B (TADA2B) ELISA Kit
abx383614-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
TADA2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2810102 1.0 ug DNA
EUR 154
TADA2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2810103 1.0 ug DNA
EUR 154
TADA2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2810104 1.0 ug DNA
EUR 154
Tada2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3129102 1.0 ug DNA
EUR 154
Tada2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3129103 1.0 ug DNA
EUR 154
Tada2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3129104 1.0 ug DNA
EUR 154
Tada2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7216402 1.0 ug DNA
EUR 154
Tada2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7216403 1.0 ug DNA
EUR 154
Tada2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7216404 1.0 ug DNA
EUR 154
TADA2B Protein Vector (Human) (pPB-C-His)
PV134538 500 ng Ask for price
TADA2B Protein Vector (Human) (pPB-N-His)
PV134539 500 ng Ask for price
TADA2B Protein Vector (Human) (pPM-C-HA)
PV134540 500 ng Ask for price
TADA2B Protein Vector (Human) (pPM-C-His)
PV134541 500 ng Ask for price
TADA2B Protein Vector (Rat) (pPB-C-His)
PV309514 500 ng
EUR 603
TADA2B Protein Vector (Rat) (pPB-N-His)
PV309515 500 ng
EUR 603
TADA2B Protein Vector (Rat) (pPM-C-HA)
PV309516 500 ng
EUR 603
TADA2B Protein Vector (Rat) (pPM-C-His)
PV309517 500 ng
EUR 603
TADA2B Protein Vector (Mouse) (pPB-C-His)
PV236090 500 ng
EUR 603
TADA2B Protein Vector (Mouse) (pPB-N-His)
PV236091 500 ng
EUR 603
TADA2B Protein Vector (Mouse) (pPM-C-HA)
PV236092 500 ng
EUR 603
TADA2B Protein Vector (Mouse) (pPM-C-His)
PV236093 500 ng
EUR 603
Tada2b 3'UTR GFP Stable Cell Line
TU170091 1.0 ml Ask for price
Tada2b 3'UTR Luciferase Stable Cell Line
TU120091 1.0 ml Ask for price
TADA2B 3'UTR GFP Stable Cell Line
TU075072 1.0 ml
EUR 2333
TADA2B 3'UTR Luciferase Stable Cell Line
TU025072 1.0 ml
EUR 2333
Tada2b 3'UTR Luciferase Stable Cell Line
TU221535 1.0 ml Ask for price
Tada2b 3'UTR GFP Stable Cell Line
TU271535 1.0 ml Ask for price
Human Transcriptional adapter 2- beta, TADA2B ELISA KIT
ELI-46305h 96 Tests
EUR 824
TADA2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629539 1.0 ug DNA
EUR 682
TADA2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629543 1.0 ug DNA
EUR 682
TADA2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629544 1.0 ug DNA
EUR 682
TADA2B Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV803913 1.0 ug DNA
EUR 572
TADA2B Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV803917 1.0 ug DNA
EUR 572
TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2810105 3 x 1.0 ug
EUR 376
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3129105 3 x 1.0 ug
EUR 376
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7216405 3 x 1.0 ug
EUR 376
TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2810106 1.0 ug DNA
EUR 167
TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2810107 1.0 ug DNA
EUR 167
TADA2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2810108 1.0 ug DNA
EUR 167
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3129106 1.0 ug DNA
EUR 167
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3129107 1.0 ug DNA
EUR 167
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3129108 1.0 ug DNA
EUR 167
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7216406 1.0 ug DNA
EUR 167
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7216407 1.0 ug DNA
EUR 167
Tada2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7216408 1.0 ug DNA
EUR 167
TADA2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV629540 1.0 ug DNA
EUR 682
TADA2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV629541 1.0 ug DNA
EUR 740