SULT1A3

SULT1A3 Antibody
ABD7889	Lifescience Market	100 ug	EUR 438

SULT1A3 Antibody
ABD8006	Lifescience Market	100 ug	EUR 438

SULT1A3 Antibody
45165-100ul	SAB	100ul	EUR 252

SULT1A3 Antibody
45165-50ul	SAB	50ul	EUR 187

SULT1A3 Antibody
DF7889	Affbiotech	200ul	EUR 304
Description: SULT1A3 Antibody detects endogenous levels of total SULT1A3.

SULT1A3 siRNA
20-abx935639	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SULT1A3 Antibody
1-CSB-PA00887A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:500-1:1000, IF:1:50-1:200

SULT1A3 Antibody
1-CSB-PA022935ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SULT1A3 Antibody
1-CSB-PA022935ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SULT1A3 Antibody
1-CSB-PA022935GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SULT1A3 Conjugated Antibody
C45165	SAB	100ul	EUR 397

SULT1A3 cloning plasmid
CSB-CL022935HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 888 Sequence: atggagctgatccaggacacctcccgcccgccactggagtacgtgaagggggtcccgctcatcaagtactttgcagaggcactggggcccctgcagagcttccaagcccgacctgatgacctgctcatcaacacctaccccaagtctggcaccacctgggtgagccagatactgga Show more
Description: A cloning plasmid for the SULT1A3 gene.

anti- SULT1A3 antibody
FNab08378	FN Test	100µg	EUR 548.75
Immunogen: sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3 Uniprot ID: P0DMM9 Gene ID: 6818 Research Area: Metabolism
Description: Antibody raised against SULT1A3

SULT1A3 / SULT1A4 Antibody
abx027053-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

SULT1A3 / SULT1A4 Antibody
abx027053-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

SULT1A3 Rabbit pAb
A12357-100ul	Abclonal	100 ul	EUR 308

SULT1A3 Rabbit pAb
A12357-200ul	Abclonal	200 ul	EUR 459

SULT1A3 Rabbit pAb
A12357-20ul	Abclonal	20 ul	EUR 183

SULT1A3 Rabbit pAb
A12357-50ul	Abclonal	50 ul	EUR 223

SULT1A3 Polyclonal Antibody
A56695	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

SULT1A3 Rabbit pAb
A7932-100ul	Abclonal	100 ul	EUR 308

SULT1A3 Rabbit pAb
A7932-200ul	Abclonal	200 ul	EUR 459

SULT1A3 Rabbit pAb
A7932-20ul	Abclonal	20 ul	EUR 183

SULT1A3 Rabbit pAb
A7932-50ul	Abclonal	50 ul	EUR 223

SULT1A3 Blocking Peptide
DF7889-BP	Affbiotech	1mg	EUR 195

Anti-SULT1A3 antibody
PAab08378	Lifescience Market	100 ug	EUR 386

Anti-SULT1A3 antibody
STJ110241	St John's Laboratory	100 µl	EUR 277
Description: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains.

Anti-SULT1A3 antibody
STJ114235	St John's Laboratory	100 µl	EUR 277
Description: Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains.

Polyclonal SULT1A3 Antibody (Center)
APR13597G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1A3 (Center). This antibody is tested and proven to work in the following applications:

SULT1A3 ELISA KIT|Human
EF003350	Lifescience Market	96 Tests	EUR 689

Human SULT1A3 shRNA Plasmid
20-abx954662	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SULT1A3 Antibody, HRP conjugated
1-CSB-PA00887B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SULT1A3 Antibody, FITC conjugated
1-CSB-PA00887C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SULT1A3 Antibody, Biotin conjugated
1-CSB-PA00887D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SULT1A3. Recognizes SULT1A3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SULT1A3 Recombinant Protein (Human)
RP100602	ABM	100 ug	Ask for price

SULT1A3 Polyclonal Antibody, HRP Conjugated
A56696	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

SULT1A3 Polyclonal Antibody, FITC Conjugated
A56697	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SULT1A3 Polyclonal Antibody, Biotin Conjugated
A56698	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Human Sulfotransferase 1A3/1A4 (SULT1A3)
1-CSB-EP022935HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Sulfotransferase 1A3/1A4(SULT1A3) expressed in E.coli

SULT1A3 ORF Vector (Human) (pORF)
ORF033535	ABM	1.0 ug DNA	EUR 405

SULT1A3 ELISA Kit (Human) (OKCA01534)
OKCA01534	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.8 pg/mL

Polyclonal SULT1A3/SULT1A4 Antibody (N-term)
APR13598G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SULT1A3/SULT1A4 (N-term). This antibody is tested and proven to work in the following applications:

SULT1A3 sgRNA CRISPR Lentivector set (Human)
K2312401	ABM	3 x 1.0 ug	EUR 339

Human Sulfotransferase 1A3/1A4, SULT1A3 ELISA KIT
ELI-18684h	Lifescience Market	96 Tests	EUR 824

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx126675	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx115892	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx145876-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx006581	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx028284-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx028284-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx321602	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx322279	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx218821	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
20-abx338720	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody
abx238378-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SULT1A3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2312402	ABM	1.0 ug DNA	EUR 154

SULT1A3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2312403	ABM	1.0 ug DNA	EUR 154

SULT1A3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2312404	ABM	1.0 ug DNA	EUR 154

Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.

Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-1mg	Novoprotein	1mg	EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.

Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-500ug	Novoprotein	500ug	EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.

Recombinant Human Sulfotransferase 1A3/SULT1A3 (N-6His)
CG03-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris,100mM NaCl, pH 8.0.

SULT1A3 Protein Vector (Human) (pPB-C-His)
PV134138	ABM	500 ng	EUR 552

SULT1A3 Protein Vector (Human) (pPB-N-His)
PV134139	ABM	500 ng	EUR 552

SULT1A3 Protein Vector (Human) (pPM-C-HA)
PV134140	ABM	500 ng	EUR 552

SULT1A3 Protein Vector (Human) (pPM-C-His)
PV134141	ABM	500 ng	EUR 552

SULT1A3 3'UTR GFP Stable Cell Line
TU074911	ABM	1.0 ml	EUR 1394

SULT1A3 3'UTR Luciferase Stable Cell Line
TU024911	ABM	1.0 ml	EUR 1394

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody (HRP)
20-abx337841	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody (FITC)
20-abx337842	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Sulfotransferase Family 1A Member 3 (SULT1A3) Antibody (Biotin)
20-abx337843	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-100ug
QP6748-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-10ug
QP6748-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-1mg
QP6748-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human SULT1A3 Protein, His-SUMO, E.coli-200ug
QP6748-ec-200ug	EnQuireBio	200ug	EUR 634