STAG1

STAG1 siRNA
20-abx935367	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STAG1 siRNA
20-abx935368	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STAG1 Antibody
1-CSB-PA022785GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAG1. Recognizes STAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- STAG1 antibody
FNab08281	FN Test	100µg	EUR 548.75
Immunogen: stromal antigen 1 Uniprot ID: Q8WVM7 Gene ID: 10274 Research Area: Cell Division and Proliferation
Description: Antibody raised against STAG1

STAG1 Rabbit pAb
A17315-100ul	Abclonal	100 ul	EUR 308

STAG1 Rabbit pAb
A17315-200ul	Abclonal	200 ul	EUR 459

STAG1 Rabbit pAb
A17315-20ul	Abclonal	20 ul	EUR 183

STAG1 Rabbit pAb
A17315-50ul	Abclonal	50 ul	EUR 223

STAG1 Polyclonal Antibody
30015-100ul	SAB	100ul	EUR 252

STAG1 Polyclonal Antibody
30015-50ul	SAB	50ul	EUR 187

STAG1 cloning plasmid
CSB-CL855483HU-10ug	Cusabio	10ug	EUR 1294
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3666 Sequence: atgattacttcagaattaccagtgttacaggattcaactaatgaaactactgcccattccgatgctggcagcgagcttgaagaaacagaggtcaaaggaaaaagaaaaaggggtcgtcctggccggcctccatctacaaataagaaacctcgaaaatctccaggtgagaagagca Show more
Description: A cloning plasmid for the STAG1 gene.

Anti-STAG1 antibody
PAab08281	Lifescience Market	100 ug	EUR 386

Anti-STAG1 antibody
STJ119445	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase.

STAG1 Polyclonal Conjugated Antibody
C30015	SAB	100ul	EUR 397

STAG1 ELISA KIT|Human
EF003279	Lifescience Market	96 Tests	EUR 689

Human STAG1 shRNA Plasmid
20-abx956956	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse STAG1 shRNA Plasmid
20-abx972902	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Stromal Antigen 1 (STAG1) Antibody
abx145100-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Stromal Antigen 1 (STAG1) Antibody
abx238281-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stag1 ORF Vector (Mouse) (pORF)
ORF058624	ABM	1.0 ug DNA	EUR 506

STAG1 ORF Vector (Human) (pORF)
ORF010093	ABM	1.0 ug DNA	EUR 95

Stag1 ORF Vector (Rat) (pORF)
ORF077102	ABM	1.0 ug DNA	EUR 506

STAG1 sgRNA CRISPR Lentivector set (Human)
K2298101	ABM	3 x 1.0 ug	EUR 339

Stag1 sgRNA CRISPR Lentivector set (Mouse)
K4489901	ABM	3 x 1.0 ug	EUR 339

Stag1 sgRNA CRISPR Lentivector set (Rat)
K6414201	ABM	3 x 1.0 ug	EUR 339

Monoclonal STAG1 Antibody (monoclonal) (M01), Clone: 2E10
AMM04140G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human STAG1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2E10. This antibody is applicable in WB, IHC and IF, E

Human Stromal Antigen 1 (STAG1) ELISA Kit
abx383497-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Stromal Antigen 1 (STAG1)ELISA Kit
201-12-2958	SunredBio	96 tests	EUR 440
This Stromal Antigen 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

STAG1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2298102	ABM	1.0 ug DNA	EUR 154

STAG1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2298103	ABM	1.0 ug DNA	EUR 154

STAG1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2298104	ABM	1.0 ug DNA	EUR 154

Stag1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4489902	ABM	1.0 ug DNA	EUR 154

Stag1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4489903	ABM	1.0 ug DNA	EUR 154

Stag1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4489904	ABM	1.0 ug DNA	EUR 154

Stag1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6414202	ABM	1.0 ug DNA	EUR 154

Stag1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6414203	ABM	1.0 ug DNA	EUR 154

Stag1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6414204	ABM	1.0 ug DNA	EUR 154

STAG1 Protein Vector (Human) (pPB-C-His)
PV040369	ABM	500 ng	EUR 329

STAG1 Protein Vector (Human) (pPB-N-His)
PV040370	ABM	500 ng	EUR 329

STAG1 Protein Vector (Human) (pPM-C-HA)
PV040371	ABM	500 ng	EUR 329

STAG1 Protein Vector (Human) (pPM-C-His)
PV040372	ABM	500 ng	EUR 329

Human Stromal Antigen 1(STAG1)ELISA Kit
QY-E02973	Qayee Biotechnology	96T	EUR 361

STAG1 Protein Vector (Rat) (pPB-C-His)
PV308406	ABM	500 ng	EUR 1191

STAG1 Protein Vector (Rat) (pPB-N-His)
PV308407	ABM	500 ng	EUR 1191

STAG1 Protein Vector (Rat) (pPM-C-HA)
PV308408	ABM	500 ng	EUR 1191

STAG1 Protein Vector (Rat) (pPM-C-His)
PV308409	ABM	500 ng	EUR 1191

STAG1 Protein Vector (Mouse) (pPB-C-His)
PV234494	ABM	500 ng	EUR 1065

STAG1 Protein Vector (Mouse) (pPB-N-His)
PV234495	ABM	500 ng	EUR 1065

STAG1 Protein Vector (Mouse) (pPM-C-HA)
PV234496	ABM	500 ng	EUR 1065

STAG1 Protein Vector (Mouse) (pPM-C-His)
PV234497	ABM	500 ng	EUR 1065

Stag1 3'UTR GFP Stable Cell Line
TU169796	ABM	1.0 ml	Ask for price

Stag1 3'UTR Luciferase Stable Cell Line
TU119796	ABM	1.0 ml	Ask for price

STAG1 3'UTR GFP Stable Cell Line
TU074761	ABM	1.0 ml	EUR 2333

STAG1 3'UTR Luciferase Stable Cell Line
TU024761	ABM	1.0 ml	EUR 2333

Stag1 3'UTR Luciferase Stable Cell Line
TU221261	ABM	1.0 ml	Ask for price

Stag1 3'UTR GFP Stable Cell Line
TU271261	ABM	1.0 ml	Ask for price

Monoclonal STAG1 / SA1 Antibody (clone 2E9), Clone: 2E9
AMM02002G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human STAG1 / SA1 (clone 2E9). The antibodies are raised in Mouse and are from clone 2E9. This antibody is applicable in WB and IHC-P, IF, E

Goat Cohesin subunit SA 1(STAG1) ELISA kit
E06C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cohesin subunit SA 1(STAG1) ELISA kit
E06C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cohesin subunit SA 1(STAG1) ELISA kit
E06C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cohesin subunit SA 1(STAG1) ELISA kit
E01C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cohesin subunit SA 1(STAG1) ELISA kit
E01C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cohesin subunit SA 1(STAG1) ELISA kit
E01C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cohesin subunit SA 1(STAG1) ELISA kit
E02C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cohesin subunit SA 1(STAG1) ELISA kit
E02C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cohesin subunit SA 1(STAG1) ELISA kit
E02C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cohesin subunit SA 1(STAG1) ELISA kit
E03C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cohesin subunit SA 1(STAG1) ELISA kit
E03C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cohesin subunit SA 1(STAG1) ELISA kit
E03C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cohesin subunit SA 1(STAG1) ELISA kit
E04C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cohesin subunit SA 1(STAG1) ELISA kit
E04C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cohesin subunit SA 1(STAG1) ELISA kit
E04C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cohesin subunit SA 1(STAG1) ELISA kit
E08C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cohesin subunit SA 1(STAG1) ELISA kit
E08C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cohesin subunit SA 1(STAG1) ELISA kit
E08C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cohesin subunit SA 1(STAG1) ELISA kit
E09C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cohesin subunit SA 1(STAG1) ELISA kit
E09C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cohesin subunit SA 1(STAG1) ELISA kit
E09C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cohesin subunit SA 1(STAG1) ELISA kit
E07C2450-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cohesin subunit SA 1(STAG1) ELISA kit
E07C2450-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cohesin subunit SA 1(STAG1) ELISA kit
E07C2450-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cohesin subunit SA- 1, Stag1 ELISA KIT
ELI-53303m	Lifescience Market	96 Tests	EUR 865

Human Cohesin subunit SA- 1, STAG1 ELISA KIT
ELI-40907h	Lifescience Market	96 Tests	EUR 824

STAG1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792979	ABM	1.0 ug DNA	EUR 316

STAG1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792980	ABM	1.0 ug DNA	EUR 316