STAG1

STAG1 Antibody
1-CSB-PA022785GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAG1. Recognizes STAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
STAG1 siRNA
20-abx935367
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAG1 siRNA
20-abx935368
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAG1 Polyclonal Antibody
30015-100ul 100ul
EUR 252
STAG1 Polyclonal Antibody
30015-50ul 50ul
EUR 187
STAG1 cloning plasmid
CSB-CL855483HU-10ug 10ug
EUR 1294
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3666
  • Sequence: atgattacttcagaattaccagtgttacaggattcaactaatgaaactactgcccattccgatgctggcagcgagcttgaagaaacagaggtcaaaggaaaaagaaaaaggggtcgtcctggccggcctccatctacaaataagaaacctcgaaaatctccaggtgagaagagca
  • Show more
Description: A cloning plasmid for the STAG1 gene.
STAG1 Rabbit pAb
A17315-100ul 100 ul
EUR 308
STAG1 Rabbit pAb
A17315-200ul 200 ul
EUR 459
STAG1 Rabbit pAb
A17315-20ul 20 ul
EUR 183
STAG1 Rabbit pAb
A17315-50ul 50 ul
EUR 223
anti- STAG1 antibody
FNab08281 100µg
EUR 548.75
  • Immunogen: stromal antigen 1
  • Uniprot ID: Q8WVM7
  • Gene ID: 10274
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against STAG1
Anti-STAG1 antibody
PAab08281 100 ug
EUR 386
Anti-STAG1 antibody
STJ119445 100 µl
EUR 277
Description: This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase.
STAG1 ELISA KIT|Human
EF003279 96 Tests
EUR 689
Mouse STAG1 shRNA Plasmid
20-abx972902
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STAG1 Polyclonal Conjugated Antibody
C30015 100ul
EUR 397
Human STAG1 shRNA Plasmid
20-abx956956
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Stromal Antigen 1 (STAG1) Antibody
abx145100-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Stromal Antigen 1 (STAG1) Antibody
abx238281-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Stag1 ORF Vector (Rat) (pORF)
ORF077102 1.0 ug DNA
EUR 506
STAG1 ORF Vector (Human) (pORF)
ORF010093 1.0 ug DNA
EUR 95
Stag1 ORF Vector (Mouse) (pORF)
ORF058624 1.0 ug DNA
EUR 506
Stag1 sgRNA CRISPR Lentivector set (Rat)
K6414201 3 x 1.0 ug
EUR 339
Stag1 sgRNA CRISPR Lentivector set (Mouse)
K4489901 3 x 1.0 ug
EUR 339
STAG1 sgRNA CRISPR Lentivector set (Human)
K2298101 3 x 1.0 ug
EUR 339
Human Stromal Antigen 1 (STAG1)ELISA Kit
201-12-2958 96 tests
EUR 440
  • This Stromal Antigen 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Stromal Antigen 1 (STAG1) ELISA Kit
abx383497-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Monoclonal STAG1 Antibody (monoclonal) (M01), Clone: 2E10
AMM04140G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STAG1 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2E10. This antibody is applicable in WB, IHC and IF, E
Stag1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6414202 1.0 ug DNA
EUR 154
Stag1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6414203 1.0 ug DNA
EUR 154
Stag1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6414204 1.0 ug DNA
EUR 154
Stag1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4489902 1.0 ug DNA
EUR 154
Stag1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4489903 1.0 ug DNA
EUR 154
Stag1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4489904 1.0 ug DNA
EUR 154
STAG1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2298102 1.0 ug DNA
EUR 154
STAG1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2298103 1.0 ug DNA
EUR 154
STAG1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2298104 1.0 ug DNA
EUR 154
STAG1 Protein Vector (Rat) (pPB-C-His)
PV308406 500 ng
EUR 1191
STAG1 Protein Vector (Rat) (pPB-N-His)
PV308407 500 ng
EUR 1191
STAG1 Protein Vector (Rat) (pPM-C-HA)
PV308408 500 ng
EUR 1191
STAG1 Protein Vector (Rat) (pPM-C-His)
PV308409 500 ng
EUR 1191
STAG1 Protein Vector (Human) (pPB-C-His)
PV040369 500 ng
EUR 329
STAG1 Protein Vector (Human) (pPB-N-His)
PV040370 500 ng
EUR 329
STAG1 Protein Vector (Human) (pPM-C-HA)
PV040371 500 ng
EUR 329
STAG1 Protein Vector (Human) (pPM-C-His)
PV040372 500 ng
EUR 329
STAG1 Protein Vector (Mouse) (pPB-C-His)
PV234494 500 ng
EUR 1065
STAG1 Protein Vector (Mouse) (pPB-N-His)
PV234495 500 ng
EUR 1065
STAG1 Protein Vector (Mouse) (pPM-C-HA)
PV234496 500 ng
EUR 1065
STAG1 Protein Vector (Mouse) (pPM-C-His)
PV234497 500 ng
EUR 1065
Human Stromal Antigen 1(STAG1)ELISA Kit
QY-E02973 96T
EUR 361
Stag1 3'UTR Luciferase Stable Cell Line
TU119796 1.0 ml Ask for price
Stag1 3'UTR GFP Stable Cell Line
TU169796 1.0 ml Ask for price
Stag1 3'UTR Luciferase Stable Cell Line
TU221261 1.0 ml Ask for price
STAG1 3'UTR GFP Stable Cell Line
TU074761 1.0 ml
EUR 2333
Stag1 3'UTR GFP Stable Cell Line
TU271261 1.0 ml Ask for price
STAG1 3'UTR Luciferase Stable Cell Line
TU024761 1.0 ml
EUR 2333
Rat Cohesin subunit SA 1(STAG1) ELISA kit
E02C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cohesin subunit SA 1(STAG1) ELISA kit
E02C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Cohesin subunit SA 1(STAG1) ELISA kit
E02C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cohesin subunit SA 1(STAG1) ELISA kit
E01C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cohesin subunit SA 1(STAG1) ELISA kit
E01C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Cohesin subunit SA 1(STAG1) ELISA kit
E01C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cohesin subunit SA 1(STAG1) ELISA kit
E03C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cohesin subunit SA 1(STAG1) ELISA kit
E03C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cohesin subunit SA 1(STAG1) ELISA kit
E03C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cohesin subunit SA 1(STAG1) ELISA kit
E06C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cohesin subunit SA 1(STAG1) ELISA kit
E06C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Cohesin subunit SA 1(STAG1) ELISA kit
E06C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cohesin subunit SA 1(STAG1) ELISA kit
E04C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cohesin subunit SA 1(STAG1) ELISA kit
E04C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cohesin subunit SA 1(STAG1) ELISA kit
E04C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cohesin subunit SA 1(STAG1) ELISA kit
E09C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cohesin subunit SA 1(STAG1) ELISA kit
E09C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Cohesin subunit SA 1(STAG1) ELISA kit
E09C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cohesin subunit SA 1(STAG1) ELISA kit
E08C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cohesin subunit SA 1(STAG1) ELISA kit
E08C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Cohesin subunit SA 1(STAG1) ELISA kit
E08C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cohesin subunit SA 1(STAG1) ELISA kit
E07C2450-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cohesin subunit SA 1(STAG1) ELISA kit
E07C2450-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Cohesin subunit SA 1(STAG1) ELISA kit
E07C2450-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Cohesin subunit SA 1(STAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Cohesin subunit SA- 1, Stag1 ELISA KIT
ELI-53303m 96 Tests
EUR 865
Monoclonal STAG1 / SA1 Antibody (clone 2E9), Clone: 2E9
AMM02002G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human STAG1 / SA1 (clone 2E9). The antibodies are raised in Mouse and are from clone 2E9. This antibody is applicable in WB and IHC-P, IF, E
Human Cohesin subunit SA- 1, STAG1 ELISA KIT
ELI-40907h 96 Tests
EUR 824
STAG1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792979 1.0 ug DNA
EUR 316
STAG1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792980 1.0 ug DNA
EUR 316