ST8SIA1

ST8SIA1 siRNA
20-abx935347
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST8SIA1 Polyclonal Antibody
31727-100ul 100ul
EUR 252
ST8SIA1 Polyclonal Antibody
31727-50ul 50ul
EUR 187
ST8SIA1 cloning plasmid
CSB-CL838738HU1-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 252
  • Sequence: atgagcccctgcgggcgggcccggcgacaaacgtccagaggggccatggctgtactggcgtggaagttcccgcggacccggctgcccatgggagccagtgccctctgtgtcgtggtcctctgttggctctacatcttccccgtctaccggctgcccaacgagaaagagatcgtgca
  • Show more
Description: A cloning plasmid for the ST8SIA1 gene.
ST8SIA1 cloning plasmid
CSB-CL838738HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgagcccctgcgggcgggcccggcgacaaacgtccagaggggccatggctgtactggcgtggaagttcccgcggacccggctgcccatgggagccagtgccctctgtgtcgtggtcctctgttggctctacatcttccccgtctaccggctgcccaacgagaaagagatcgtgc
  • Show more
Description: A cloning plasmid for the ST8SIA1 gene.
ST8SIA1 Rabbit pAb
A9648-100ul 100 ul
EUR 308
ST8SIA1 Rabbit pAb
A9648-200ul 200 ul
EUR 459
ST8SIA1 Rabbit pAb
A9648-20ul 20 ul
EUR 183
ST8SIA1 Rabbit pAb
A9648-50ul 50 ul
EUR 223
anti- ST8SIA1 antibody
FNab08275 100µg
EUR 585
  • Immunogen: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
  • Uniprot ID: Q92185
  • Gene ID: 6489
  • Research Area: Metabolism
Description: Antibody raised against ST8SIA1
Anti-ST8SIA1 antibody
PAab08275 100 ug
EUR 412
Anti-ST8SIA1 antibody
STJ116365 100 µl
EUR 277
Description: Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene.
ST8SIA1 ELISA KIT|Human
EF003272 96 Tests
EUR 689
Bovine ST8SIA1 ELISA KIT
ELI-52948b 96 Tests
EUR 928
Human ST8SIA1 ELISA KIT
ELI-53245h 96 Tests
EUR 824
Mouse ST8SIA1 shRNA Plasmid
20-abx972698
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST8SIA1 Polyclonal Conjugated Antibody
C31727 100ul
EUR 397
Human ST8SIA1 shRNA Plasmid
20-abx954385
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse St8sia1 ELISA KIT
ELI-39356m 96 Tests
EUR 865
ST8SIA1 Recombinant Protein (Rat)
RP231275 100 ug Ask for price
ST8SIA1 Recombinant Protein (Human)
RP043792 100 ug Ask for price
ST8SIA1 Recombinant Protein (Human)
RP030265 100 ug Ask for price
ST8SIA1 Recombinant Protein (Mouse)
RP175829 100 ug Ask for price
St8sia1 ORF Vector (Rat) (pORF)
ORF077093 1.0 ug DNA
EUR 506
ST8SIA1 ORF Vector (Human) (pORF)
ORF014598 1.0 ug DNA
EUR 354
ST8SIA1 ORF Vector (Human) (pORF)
ORF010089 1.0 ug DNA
EUR 95
St8sia1 ORF Vector (Mouse) (pORF)
ORF058611 1.0 ug DNA
EUR 506
Anti-ST8SIA1 (Mitumomab)-SMCC-DM1 ADC
ADC-W-1778 1mg Ask for price
Description: This ADC product is comprised of an anti-ST8SIA1 monoclonal antibody conjugated via a SMCC linker to DM1
Anti-ST8SIA1 (Mitumomab)-SPDB-DM4 ADC
ADC-W-1779 1mg Ask for price
Description: This ADC product is comprised of an anti-ST8SIA1 monoclonal antibody conjugated via a SPDB linker to DM4
Anti-ST8SIA1 (Mitumomab)-MC-MMAF ADC
ADC-W-1780 1mg Ask for price
Description: This ADC product is comprised of an anti-ST8SIA1 monoclonal antibody conjugated via a MC linker to MMAF
St8sia1 sgRNA CRISPR Lentivector set (Rat)
K6893601 3 x 1.0 ug
EUR 339
St8sia1 sgRNA CRISPR Lentivector set (Mouse)
K4339401 3 x 1.0 ug
EUR 339
ST8SIA1 sgRNA CRISPR Lentivector set (Human)
K2296401 3 x 1.0 ug
EUR 339
St8sia1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6893602 1.0 ug DNA
EUR 154
St8sia1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6893603 1.0 ug DNA
EUR 154
St8sia1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6893604 1.0 ug DNA
EUR 154
St8sia1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4339402 1.0 ug DNA
EUR 154
St8sia1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4339403 1.0 ug DNA
EUR 154
St8sia1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4339404 1.0 ug DNA
EUR 154
ST8SIA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2296402 1.0 ug DNA
EUR 154
ST8SIA1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2296403 1.0 ug DNA
EUR 154
ST8SIA1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2296404 1.0 ug DNA
EUR 154
ST8SIA1 Protein Vector (Rat) (pPB-C-His)
PV308370 500 ng
EUR 603
ST8SIA1 Protein Vector (Rat) (pPB-N-His)
PV308371 500 ng
EUR 603
ST8SIA1 Protein Vector (Rat) (pPM-C-HA)
PV308372 500 ng
EUR 603
ST8SIA1 Protein Vector (Rat) (pPM-C-His)
PV308373 500 ng
EUR 603
ST8SIA1 Protein Vector (Human) (pPB-C-His)
PV058389 500 ng
EUR 481
ST8SIA1 Protein Vector (Human) (pPB-N-His)
PV058390 500 ng
EUR 481
ST8SIA1 Protein Vector (Human) (pPM-C-HA)
PV058391 500 ng
EUR 481
ST8SIA1 Protein Vector (Human) (pPM-C-His)
PV058392 500 ng
EUR 481
ST8SIA1 Protein Vector (Human) (pPB-C-His)
PV040353 500 ng
EUR 329
ST8SIA1 Protein Vector (Human) (pPB-N-His)
PV040354 500 ng
EUR 329
ST8SIA1 Protein Vector (Human) (pPM-C-HA)
PV040355 500 ng
EUR 329
ST8SIA1 Protein Vector (Human) (pPM-C-His)
PV040356 500 ng
EUR 329
ST8SIA1 Protein Vector (Mouse) (pPB-C-His)
PV234442 500 ng
EUR 603
ST8SIA1 Protein Vector (Mouse) (pPB-N-His)
PV234443 500 ng
EUR 603
ST8SIA1 Protein Vector (Mouse) (pPM-C-HA)
PV234444 500 ng
EUR 603
ST8SIA1 Protein Vector (Mouse) (pPM-C-His)
PV234445 500 ng
EUR 603
St8sia1 3'UTR Luciferase Stable Cell Line
TU119785 1.0 ml Ask for price
St8sia1 3'UTR GFP Stable Cell Line
TU169785 1.0 ml Ask for price
St8sia1 3'UTR Luciferase Stable Cell Line
TU221251 1.0 ml Ask for price
ST8SIA1 3'UTR GFP Stable Cell Line
TU074724 1.0 ml
EUR 4617
St8sia1 3'UTR GFP Stable Cell Line
TU271251 1.0 ml Ask for price
ST8SIA1 3'UTR Luciferase Stable Cell Line
TU024724 1.0 ml
EUR 4617
Anti-ST8SIA1 (Mitumomab)-MC-Vc-PAB-MMAE ADC
ADC-W-1781 1mg Ask for price
Description: This ADC product is comprised of an anti-ST8SIA1 monoclonal antibody conjugated via a MC-Vc linker to MMAE
Anti-ST8SIA1 (Mitumomab)-MC-Vc-PAB-SN38 ADC
ADC-W-1782 1mg Ask for price
Description: This ADC product is comprised of an anti-ST8SIA1 monoclonal antibody conjugated via a MC-Vc-PAB linker to SN38
ST8SIA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV701751 1.0 ug DNA
EUR 450
ST8SIA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV701755 1.0 ug DNA
EUR 450
ST8SIA1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV701756 1.0 ug DNA
EUR 450
ST8SIA1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV625375 1.0 ug DNA
EUR 682
ST8SIA1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV625379 1.0 ug DNA
EUR 682
ST8SIA1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV625380 1.0 ug DNA
EUR 682
Human Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E01A1997-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E01A1997-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E01A1997-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E03A1997-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E03A1997-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E03A1997-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E06A1997-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E06A1997-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E06A1997-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E04A1997-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E04A1997-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E04A1997-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) ELISA kit
E02A1997-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha N acetylneuraminide Alpha 2,8 sialyltransferase(ST8SIA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.